Разнообразие праймеров для ПЦР и принципы их подбора

22.06.2019
Авторы:
Гарафутдинов Р.Р. , Баймиев Ан.Х. , Малеев Г.В. , Алексеев Я.И. , Зубов В.В. , Чемерис Д.А., , Кирьянова О.Ю. , Губайдуллин И.М. , Матниязов Р.Т. , Сахабутдинова А.Р. , Никоноров Ю.М. , Кулуев Б.Р. , Баймиев Ал.Х. , Чемерис А.В.
Название:
Разнообразие праймеров для ПЦР и принципы их подбора
Страницы:
23-70
скачано
22 раз(а)


Праймеры являются очень важным компонентом ПЦР, поскольку специфичность амплификации зависит в первую очередь от них. Хотя на эффективность ПЦР влияет много факторов, но и праймеры вносят немалый вклад в этот процесс. В данном обзоре уделено значительное внимание принципам подбора праймеров и требованиям, предъявляемым при их дизайне, проводимым с использованием соответствующих компьютерных программ. Рассмотрены вопросы элиминации праймерных димеров, а также термодинамики дуплексных структур ДНК и их температур плавления, во многом зависящим не только от GC-состава, но и от стэкинг-взаимодействий соседних нуклеотидов. Показана применимость NN модели термодинамики ДНК для определения температур плавления и отжига праймеров. Приведены различные формулы подсчета этих температур. Отдельно рассмотрены так называемые вырожденные праймеры, праймеры с экстрапоследовательностями на 5'-конце, модифицированные и дискриминирующие праймеры. Не остались без внимания вопросы химического и ферментативного синтеза олигонуклеотидов, включившие также исторические аспекты.
Введение  Праймеры являются чрезвычайно важной составляющей любого процесса амплификации, включая ПЦР. Для того чтобы химически синтезированные олигонуклеотидные праймеры (или иным способом приготовленные) могли служить затравочными молекулами для ферментативного синтеза комплементарных цепей ДНК, необходим их отжиг на подходящей одноцепочечной нуклеиновой кислоте с образованием одно/двухцепочечного стартового комплекса с наличием способного к удлинению по одноцепочечной ДНК/РНК-матрице спаренного 3'-конца такого праймера, несущего на нем гидроксильную группу. Отжиг праймеров на матрице может происходить в широком диапазоне температур, который зависит от длины конкретного праймера, а также от его химического состава и в этой связи можно напомнить, что A-T-пары образуют между собой две водородные связи, а G-C-пары - три водородные связи, что вносит существенный вклад в температурные оптимумы при молекулярной гибридизации нуклеиновых кислот с разными GC- и AT-составами.         Как имеется множество вариаций ПЦР, решающих часто весьма разные задачи, так существуют и довольно сильно отличающиеся принципы подбора олигонуклеотидных праймеров. Например, в целях диагностики необходимо выявлять наличие подходящего фрагмента ДНК или РНК (по сути - любого, но специфичного именно для выявляемого организма) и поэтому в таких случаях праймеры подбираются, исходя из задач обнаружения выбранного участка с максимальной достоверностью и экономией (времени, денежных и прочих ресурсов), тем более, если такие анализы должны носить массовый характер. При проведении научных исследований часто возникают задачи по клонированию конкретного гена, у которого есть начало и конец и в этом случае праймеры для его амплификации подбираются не с целью достичь максимальной эффективности процесса, а так чтобы было удобно вести дальнейшие эксперименты, но при этом праймеры могут оказаться далеко не самыми оптимальными по целому ряду параметров. Наконец, с помощью ПЦР изучают полиморфизм ДНК разных организмов - видов, сортов/пород, отдельных особей или индивидов. В таких случаях праймеры подбираются с таким расчетом, чтобы вариабельный участок оказывался между ними, что также накладывает определенные ограничения. Во многих подходах для генотипирования организмов вообще используются праймеры с произвольными последовательностями, не заботясь о присутствии для них мест отжига в геномах, поскольку они выбираются весьма короткими (часто от 10 до 12 нуклеотидов) и отжигаться на множестве мест теоретически должны. Подробные обзоры таких способов амплификации неопределенных фрагментов ДНК были сделаны нами не так давно [Кулуев и др., 2018; Сухарева, Кулуев, 2018] и поэтому здесь на праймерах для таких вариантов ПЦР останавливаться не будем.        Относительно взаимного расположения мест отжига праймеров, определяющих размер(ы) ампликонов, которые на самом деле диктуются многими привходящими обстоятельствами, то этот вопрос имеет больше отношения к эффективности процесса амплификации. В данной статье будут изложены главные принципы подбора праймеров, различные основные требования, предъявляемые к ним с учетом решаемых в каждом конкретном случае своих задач. Значительное внимание будет уделено различным модификациям праймеров, включая вырожденные праймеры, тогда как специальных праймеров для различных вариаций ПЦР коснемся довольно кратко. Есть также масса и других задач, решаемых с помощью ПЦР, под которые подбираются специализированные праймеры. Однако ни в одной даже очень большой статье невозможно рассмотреть все многообразие праймерных систем, применяемых в ПЦР. Что касается праймеров, используемых в различных способах изотермической амплификации нуклеиновых кислот, имеющих свои особенности, то они также останутся за пределами рассмотрения.          Синтез праймеров  Необходимо кратко остановиться на химическом синтезе олигонуклеотидов и истории этого вопроса. Заинтересованным же читателям можно порекомендовать несколько обзорных статей о развитии методов синтеза олигонуклеотидов [Khorana, 1979; Caruthers, 1985; Becauge, Iyer, 1992; Brown, 1993; Reese, 2005; Roy, Caruthers, 2013]. Химический синтез первого динуклеотида pTpT с природной фосфодиэфирной связью был произведен в лаборатории А.Тодда - будущего лауреата Нобелевской премии по химии 1957 г. [Michelson, Todd, 1955]. При этом ими был использован метод синтеза, позже названный фосфотриэфирным и оказавшийся забытым на целое десятилетие. Также под руководством А.Тодда был синтезирован динуклеотид аденозин-уридин фосфат [Hall et al., 1957], что было сделано уже с помощью другого метода, только через три десятилетия обретшего новое рождение в виде H-фосфонатного метода синтеза олигонуклеотидов [Froehler et al., 1986; Garegg et al., 1986]. Одной из причин забвения тогда этих подходов было появление в те же годы фосфодиэфирного метода синтеза олигонуклеотидов [Gilham, Khorana, 1958], разработанного под руководством другого Нобелевского лауреата по физиологии и медицине 1968 г. Х.Г.Кораны. Так, фосфодиэфирный метод синтеза надолго стал основным методом, с помощью которого велся синтез олигонуклеотидов, и оставался таковым до начала 70-х гг. прошлого столетия. При этом одним из главных его недостатков была крайне низкая скорость конденсации, из-за чего на синтез олигонуклеотида длиной 12 звеньев уходило почти три месяца. Причем, такой синтез был под силу только высококлассным химикам.         В середине 60-х гг. внимание исследователей оказалось вновь обращено на фосфотриэфирный метод, после того как был предложен его твердофазный вариант [Letsinger, Mahadevan, 1966] и разработан ряд прочих вариаций этого способа [Eckstein, Rizk, 1967; Reese, Saffhill, 1968]. В середине 1970-х гг. было обнаружено, что трехвалентный фосфор гораздо реакционноспособнее, нежели пятивалентный, что привело к разработке нового метода синтеза олигонуклеотидов, названного фосфиттриэфирным [Letsinger et al., 1975; Letsinger, Lunsford, 1976] и получившего дальнейшее развитие, в том числе в твердофазном варианте [Matteucci, Caruthers, 1981], что явилось важным шагом к автоматизации всего процесса. Наибольшего прорыва удалось добиться, когда был разработан вариант фосфиттриэфирного метода синтеза олигонуклеотидов, названный амидофосфитным [Becauge, Caruthers, 1981]. Его особенно серьезное преимущество выявилось после того как стал в качестве активатора использоваться 1H-тетразол [McBride, Caruthers, 1983]. Целый ряд дальнейших улучшений амидофосфитного метода привел к тому, что в настоящее время он стал основным методом синтеза олигонуклеотидов.         Автоматический синтез олигонуклеотидов сейчас осуществляется с помощью специальных приборов - ДНК синтезаторов, появление которых пришлось на первую половину 1980-х гг. [Alvarado-Urbina et al., 1981; Hunkapillar et al., 1984; Caruthers, 1985]. Синтез ведется на специальных носителях, представляющих собой твердую фазу, которой обычно служит стекло с определенными размерами пор либо слабонабухающие макропористые полистирольные шарики. К таким носителям, как правило, ковалентно присоединен тот или иной 3'-концевой нуклеотид. В амидофосфитном методе для синтеза используются амидофосфиты, являющиеся фактически обычными азотистыми основаниями, в которых все реакционноспособные группы (амино-, гидроксильные, фосфатные) защищены соответствующими блокаторами нежелательных реакций, большинство которых удаляются по завершению всего синтеза, тогда как 4,4'-диметокситритильная группа, защищающая гидроксил в 5'-положении, удаляется в начале каждого цикла, поскольку именно к данному месту присоединяется очередное звено. Могут использоваться и другие амидофосфиты, служащие, в том числе, для введения различных реакционных групп, используемых обычно пост-синтетически для мечения олигонуклеотидов флуоресцентными красителями, биотином, прочими модификациями. Сейчас на синтез, например, 25-звенного олигонуклеотида с активацией тетразолом или его аналогами уходит всего около трех часов в отличие от многих месяцев, требовавшихся на такой синтез фосфодиэфирным методом, не говоря уже о крайне низком прежде выходе конечного олигонуклеотида.        Олигонуклеотидный синтез заключается в циклическом повторении реакций депротекции (удаление тритильной защиты), конденсации, кэпирования, окисления, что осуществляется путем пошагового добавления соответствующих реагентов. Следует отдельно остановиться на стадии кэпирования, в ходе которой происходит выведение из дальнейшего процесса синтеза непрореагировавшей во время конденсации части 5'-гидроксильных групп (0,1 - 1%), что предотвращает образование неправильных продуктов с отсутствующими нуклеотидными остатками внутри цепи. По завершению синтеза производится снятие всех защитных групп и самого нуклеотида с твердофазного носителя, что приводит к появлению функциональной одноцепочечной ДНК с гидроксильными группами на 3'- и 5'-концах (в случае синтеза обычного немодифицированного олигонуклеотида), но в растворе остаются органические загрязнения из защитных групп, в связи с чем готовый олигонуклеотид необходимо обессолить. Дальнейшая очистка синтезированного олигонуклеотида с помощью электрофореза в полиакриламидном геле или высокоэффективной жидкостной хроматографии зависит от его состава (модификаций) и стоящих задач. При эффективности олигонуклеотидного синтеза амидофосфитным методом, превышающей обычно 99%, выход целевого продукта в виде 25-звенного олигонуклеотида составляет около 90% и из них менее 1% может быть представлено олигонуклеотидом из 24 звеньев (N-1), причем недоставать будет только концевого малозначимого нуклеотида на 5'-конце.         Синтез олигонуклеотидов обычно ведется в направлении 3'к 5' и это важно знать для того, чтобы понимать, что самый критичный 3'-нуклеотид в праймере (о чем подробно будет говориться ниже) является первым при синтезе и часто "пришит" к твердофазному носителю и НЕ МОЖЕТ отсутствовать в последовательности праймера, что при использовании неочищенных от более коротких олигонуклеотидов (N-1, N-2 и т.д.) не будет, как правило, сильно искажать результаты стандартной ПЦР, кроме тех случаев, где для дальнейших действий экспериментатору (например, для молекулярного клонирования) крайне важна полная последовательность праймера. При этом все же стоить заметить, что разработан также вариант синтеза олигонуклеотидов амидофосфитным методом в направлении 5'к 3' [Wagner, Pfeiderer, 2000], но он значительно дороже (ввиду гораздо меньшего масштаба использования) и применяется для особых целей, малосвязанных с обычной, в первую очередь диагностической ПЦР. Также необходимо заметить, что при любом из этих вариантов синтеза у олигонуклеотидов на 5'-конце будет отсутствовать присущая природной ДНК фосфатная группа, и для ее введения во время синтеза необходимо использовать специальный синтон или проводить постсинтетическую модификацию, о чем будет говориться дальше.        В те годы, когда ПЦР еще не существовала, основное предназначение олигонуклеотидов заключалось в их использовании в качестве праймеров при ферментативном секвенировании ДНК по Сэнгеру; в качестве гибридизационных проб в экспериментах по блот-гибридизации по Саузерну и им подобным процедурам, а также при проведении сайт-направленного мутагенеза и некоторых других исследованиях. Поэтому проблема обладания экспериментаторами соответствующими олигонуклеотидами, хотя и стояла довольно остро, но уже появившиеся к тому времени коммерческие автоматические ДНК-синтезаторы более-менее обеспечивали растущие потребности. К тому же осуществлялся в то время и ручной синтез олигонуклеотидов [Tanaka, Letsinger, 1982], комплекты для проведения которого поставлялись рядом фирм. И даже после появления первого варианта метода ПЦР публиковались протоколы по ручному синтезу олигонуклеотидов как фосфотриэфирным [O'Callaghan, Donnelly, 1988], так и более передовым амидофосфитным методами [White, 1988]. В качестве некоего подтверждения определенного дефицита олигонуклеотидов в те годы может служить письмо [Willems, 1989] редактору журнала Nature, опубликованное в номере за 5 января 1989 г., в котором отмечался огромный потенциал ПЦР и одновременно автор сетовал на малодоступность олигонуклеотидных праймеров большинству экспериментаторов отчасти из-за их дороговизны и предлагал при одной из биологических коллекций за счет небольших взносов заинтересованных лабораторий создать некий депозитарий таких молекул ДНК, которые могли бы рассылаться по запросам. Но этого не потребовалось, поскольку заказной синтез олигонуклеотидов стал расти буквально семимильными шагами и начиная с февральских номеров того же 1989 г. в том же журнале Nature (да и в других профильных журналах), ряд специализирующихся на этом бизнесе фирм стали размещать рекламные объявления о синтезе олигонуклеотидов по цене 7,5 - 10 долларов за звено. Причем такой заказной синтез отчасти благодаря сильной конкуренции стал очень быстро резко дешеветь.         Упомянув выше о том, что праймеры могут быть получены не только чисто химическим путем, а и иным способом, для подтверждения такой возможности следует сослаться на некоторые статьи. Так, на протяжении ряда лет велись работы по разработке способов энзиматического синтеза олигонуклеотидов с заданной последовательностью [Gillam, Smith, 1972; Gillam et al., 1974; 1978], но серьезную конкуренцию химическим подходам они составить не могли. Объединение химического и биологического способов при получении праймеров описано в статье, в которой 18-звенные праймеры создавали лигированием шести гексануклеотидов [Dunn et al., 1995]. Для этого все шесть олигонуклеотидов отжигались друг на друге с таким расчетом, что возникало две цепи с выступающими тремя нуклеотидами по концам. Два внутренних олигонуклеотида одной цепи заранее фосфорилировались, что обеспечивало их лигирование с помощью Т4 ДНК лигазы. В итоге после тепловой денатурации в растворе оставался 18-звенный праймер и три непролигировавших 6-ти звенных олигонуклеотида другой цепи, которые ввиду своей малой длины мешать не могут. Данный подход по мнению авторов позволял из библиотеки всех возможных 4096 гексануклеотидов по крайней 82% таковых использовать для синтеза многочисленных 18-мерных праймеров лигированием. С помощью Т4 РНК лигазы было предложено готовить композитные праймеры, 3'-часть которых представляла собой ген-специфичную последовательность, а на 5'-конце располагался экстра-участок, необходимый для клонирования или иных пост-амплификационных процедур, который может быть общим для многих праймеров, что несколько удешевляет их стоимость [Kaluz et al., 1995]. Было предложено из библиотеки коротких олигонуклеотидов с помощью ДНК полимеразы готовить длинные праймеры, показавшие свою пригодность в ПЦР [Cairns et al., 2009]. Однако в настоящее время подобные подходы для создания праймеров полностью потеряли свою актуальность. Отдельно необходимо выделить используемые в сайт-направленном мутагенезе так называемые мегапраймеры, длина которых может составлять и 300 и даже 800 нуклеотидов [Kammann et al., 1989; Barik, 2002; Lai et al., 2003]. Собственно такие мегапраймеры представляют собой ампликоны, получаемые на первой стадии ПЦР, которые уже затем используют в виде затравочных молекул на второй стадии. Недавно предложен новый ферментативный способ пошагового синтеза олигонуклеотидов с заданной последовательностью на основе конъюгатов фермента терминальной трансферазы, обладающей способностью нематричного синтеза цепи ДНК, и конкретных дНТФ [Palluk et al., 2018]. Причем на весь процесс такого присоединения одного нуклеотида, включая удаление непрореагироваших ингредиентов, уходит всего от 10 до 20 сек и авторы вполне резонно говорят о возможности создания на этом принципе автоматического ДНК синтезатора нового типа.  Основные требования к праймерам (дизайн праймеров)  Принимая во внимание большое значение, придаваемое дизайну праймеров, ввиду того, что от их характеристик во многом зависит успешное протекание ПЦР, этому вопросу уделено множество методических руководств и экспериментальных статей. Причем весьма часто в них можно встретить практически диаметрально противоположные мнения, что, впрочем, лишь подчеркивает, что единого подхода к выбору нуклеотидных последовательностей для их использования в качестве праймеров быть не может. Немало опубликовано и обзорных работ, посвященных дизайну праймеров, лишь часть которых здесь упомянем [Dieffenbach et al., 1993; Hyndman, Mitsuhashi, 2003; Alvarez-Fernandez, 2013; Chuang et al., 2013; Noguera et al., 2014]. Поскольку ПЦР уже настолько прочно вошла в нашу жизнь и используется в очень многих отраслях человеческой деятельности, то в целом ряде работ разных лет дается описание как следует учить студентов навыкам дизайна праймеров в ходе различных лабораторных практикумов [Kim, 2000; Lima, Garces, 2006; Phillips et al., 2008; Robertson, Phillips, 2008].   Праймеры в ПЦР должны отвечать главным требованиям в виде обеспечения специфичности процесса амплификации и его эффективности. При этом, если специфичность ПЦР действительно в значительной степени определяется праймерами, то на эффективность ПЦР даже более сильное влияние оказывают прочие факторы. Специфичность ПЦР во многом зависит от длины праймеров, но вкупе с применяемой для их отжига температурой [Wu et al., 1991], а также от последовательности нуклеотидов в них, вариантов которой может быть великое множество. Но сначала следует коснуться длины праймеров. При этом здесь подразумевается, что праймеры полностью отжигаются на матрице, формируя канонические Уотсон-Криковские1 пары и не образуя неспаренных нуклеотидов. Так, исходя из числа возможных комбинаций перемежения нуклеотидов и вероятности их нахождения в геномах тех или иных размеров, можно рассчитать, что в человеческом геноме с его 3 млрд.п.н. или в геномах других организмов, приблизительно равных ему по размерам, некая случайная последовательность длиной 16 нуклеотидов может не встретиться ни разу. То есть праймеры такой длины в этих случаях уже будут отвечать требованиям специфичности, однако все же лучше использовать более длинные праймеры, например, от 18 до 25 нуклеотидов. При этом каждое увеличение праймера на один нуклеотид означает снижение вероятности нахождения мест для его отжига в каком-либо геноме в 4 раза. Равным образом это фактически в пределах указанного диапазона длины олигонуклеотидов приводит к увеличению специфичности ПЦР в те же 4 раза при условии соответствующего повышения температуры отжига на нужное количество градусов в зависимости от типа добавленного нуклеотида и соседнего с ним при обеспечении при отжиге полного спаривания. Все это в теории, безусловно, так, но на практике по мере увеличения общего количества секвенированных нуклеотидных последовательностей и их помещения в международные банки данных в какой-то момент настал этап, когда стало актуальным и даже обязательным проверять потенциальную возможность отжига подобранных праймеров на неспецифичных местах, запуская в режиме on-line соответствующий поиск гомологичных участков с помощью программы BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi), хотя и такой подход может давать неоднозначные сведения. Рекомендуется использовать более подходящую для этой цели программу ThermoBLAST, входящую в пакет программ фирмы DNA Software, Inc. [SantaLucia, 2007].  Недостатком длинных праймеров может являться так называемое фальш-праймирование, когда в случае неполного спаривания ввиду неоптимальной (сниженной) температуры отжига общее количество образовавшихся в разных местах водородных связей между комплементарными нуклеотидами матрицы и праймера при условии полного спаривания подпоследовательности на 3'-конце такого олигонуклеотида может привести к его удержанию на матрице в течение некоторого времени и соответственно к его удлинению и как результат к ложно-позитивной амплификации. Но стоит только фальш-праймированию произойти один раз как через цикл в составе ампликона будет уже иметься последовательность, полностью комплементарная отжегшемуся ранее только частично праймеру и в последующих циклах никаких проблем с отжигом не возникнет, что приведет к амплификации нецелевых ампликонов. Считается, что для сведения к минимуму неспецифичной амплификации необходимо, чтобы праймеры имели большую стабильность связывания с матрицей на 5'-концах, нежели на 3'-концах [Rychlik, 1993].  Обычно ПЦР представляет собой двухпраймерную амплификацию, в которой один из праймеров условно считается прямым, а второй - обратным. При этом существуют варианты ПЦР, в которых используется только один праймер, но он в этих случаях выполняет роли и прямого и обратного. При этом надо принимать во внимание, что даже при ПЦР с двумя находящимися в реакционной смеси праймерами реально затравочной молекулой может оказаться только один из праймеров, также служа одновременно прямым и обратным, что и в этом случае приведет к ложно-позитивной ПЦР [Hiltunen et al., 1994; Luo, Diamandis, 1999; Ma et al., 2011]. При подозрении на такую амплификацию можно рекомендовать провести ПЦР по отдельности с каждым из пары праймеров и в случае выявления ампликона сходного размера, образуемого одним праймером, этот праймер надо будет подбирать заново.   Одна из ранних работ по ПЦР была посвящена вопросу достаточности числа спариваемых нуклеотидов в составе праймеров для обеспечения специфичности процесса [Sommer, Tautz, 1989]. Для этого были синтезированы отличающиеся количеством замен многочисленные праймеры длиной 17-20 звеньев, ПЦР с которыми показала, что достаточно всего трех спаренных нуклеотидов на 3'-конце праймера, чтобы происходила амплификация, тогда как двух уже не хватало. Не ставим под сомнение полученный авторами результат, но считаем необходимым заметить, что в их экспериментах в качестве матрицы в реакционной смеси присутствовала не тотальная ДНК, а линеаризованная плазмида в количестве 100 пкг, что соответствует приблизительно 107 копиям и совсем не удивительно, что искомый продукт за 25 циклов нарабатывался. К тому же температура отжига была всего 37оС и этап этот длился целых 2 мин. Но это ничуть не означает, что и в обычной ПЦР с использованием геномной ДНК какого-либо организма для удлинения праймера в некоторых случаях не будет достаточно всего трех спаренных нуклеотидов на его 3'-конце, чтобы ДНК-полимераза начала вести синтез. Чуть позже была опубликована статья, в которой было подтверждено, что в случае чрезмерно высокой концентрации матричной ДНК специфичность амплификации может быть потеряна [Sarkar et al., 1990]. В этой же работе было продемонстрировано, что когда или 3'-концевой нуклеотид или следующий за ним с матрицей не спариваются, то амплификации не происходит, тогда как замены в третьем или четвертом положениях не сильно мешали протеканию ПЦР, но в этих случаях требовалось подбирать концентрации хлористого магния, который весьма важен и для специфичности амплификации и ее эффективности, но требует отдельного рассмотрения в статье, посвященной оптимизации условий ПЦР.  Но не только длина праймеров, а и последовательность нуклеотидов в них определяет специфичность ПЦР. Поэтому все же правильнее говорить о взаимосвязи этих двух характеристик праймеров. Так, например, любая последовательность нуклеотидов некоего 12-мерного праймера будет (может) встречаться в крупных геномах высших организмов несколько или даже много раз, однако и более длинный, например, 24-звенный праймер с повторяющимся 8 раз мотивом CTG - CTGCTGCTGCTGCTGCTGCTGCTG не будет уникальным ввиду того, что, например, в геноме человека эта и им подобные повторяющиеся последовательности весьма распространены и такой праймер может отжигаться как на множестве мест во всем геноме, так и внутри таких повторов со сдвигом на размер повтора (в данном случае - на три нуклеотида).   Серьезную проблему ухудшения специфичности и эффективности ПЦР несет в себе образование так называемых праймерных димеров со способными к удлинению их 3'-концами, причем они могут образовываться как между разными типами праймеров (прямым и обратным) и это будут гетеродимеры, так и любой из праймеров сам может формировать такие димеры, называемые гомодимерами. Более того, образование праймерных димеров способно приводить как к ложно-позитивным, так и к ложно-негативным результатам ПЦР. В первом случае амплификация будет иметь место, но размер ампликона будет совсем иным (коротким) и при анализе по конечной точке неспецифика будет выявлена, тогда как при детекции амплификации в режиме реального времени (в некоторых вариантах) праймерные димеры могут оказаться незамеченными, хотя последующее плавление ампликонов также может выявить накопление ложного продукта, имеющего меньшие размеры, чем ожидаемый и плавящегося соответственно быстрее. Вероятность получить ложно-негативный результат может быть вызвана тем, что праймеры, отжигаясь и достраиваясь друг на друге, приобретут иную подпоследовательность 3'-конца и тем самым фактически будут полностью исключены из реакционной смеси как специфичные праймеры, став неспецифичными.         Потенциальное число праймерных димеров зависит также от числа используемых в конкретной ПЦР праймеров и подчиняется формуле 2n2 + n, где n - число пар праймеров. Также справедлива (в частности для однопраймерной ПЦР) формула (m2 + m)/2, где m - число праймеров. Таким образом, для двухпраймерной ПЦР максимальное число праймерных димеров составит 3, два из которых принадлежат гомодимерам прямого и обратного праймеров, а один - гетеродимеру. В случае так называемой мультиплексной ПЦР2 число потенциальных димеров растет с катастрофической быстротой. При этом еще необходимо учитывать, что приведенные выше формулы действуют лишь при условии, что каждый праймер или их пара могут образовывать только один димерный вариант, тогда как нельзя исключать, что праймеры могут отжигаться друг на друге по-разному, что потенциально может приводить к образованию нескольких димеров для одного праймера или их пары. Результатом образования праймерных димеров любой природы со способными удлиняться их 3'-концами может оказаться как заметное снижение эффективности наработки целевого ампликона, так и полная невозможность проведения ПЦР. При этом самоотжиг праймеров и образование димеров с непригодными к удлинению 3'-концами не представляют серьезной угрозы протеканию ПЦР, поскольку при повышении температуры они будут диссоциировать.         Как уже говорилось, 3'-концы праймеров ответственны как за истинное, так и за фальш-праймирование. В литературе содержится немало рекомендаций по выбору тех или иных отдельных нуклеотидов или их последовательностей на 3'-конце, а также в прилегающей области. Некоторые из таких рекомендаций основаны на теоретических выкладках, тогда как другие - на практических результатах успешной амплификации. Так, были проанализированы все 64 возможных триплета, находящихся на 3'-концах 2137 праймеров, внесенных в базу данных VirOligo, что позволило сделать определенные выводы [Onodera, Melcher, 2004; Onodera, 2007]. Наиболее "популярной" (что отнюдь не означает - наиболее хорошей) оказалась последовательность AGG, которая встречалась в праймерах почти в 8 раз чаще, чем TTA. При этом 12 из 13 чаще остальных использованных в этом месте триплетов содержали нуклеотиды S (C и G), что до некоторой степени противоречит устоявшемуся мнению, что 3'-конец праймеров не должен иметь обогащенную GC нуклеотидами подпоследовательность, поскольку она может способствовать частичному отжигу праймеру, сопровождающемуся удлинением такого затравочного комплекса ДНК полимеразой и как следствие фальш-праймированию [Mitsuhashi, 1996]. Но праймеры с AT-богатыми подпоследовательностями на 3'-концах не столь эффективно инициируют полимеризацию ДНК и в этом вопросе, безусловно, должен соблюдаться определенный баланс между эффективностью праймирования и неспецифичным отжигом праймеров [Miura et al., 2005].         Есть несколько подходов для противодействия образованию праймерных димеров. Во-первых, на этапе подбора праймеров должны быть исключены такие их последовательности, которые при определенных температурах способны отжигаться друг на друге (или на себе подобных) с образованием достраиваемого 3'-конца. Но как говорилось выше подобрать такие праймеры бывает возможно не всегда, особенно когда они требуются "по месту". Некими идеальными праймерами можно считать варианты с двумя AA на 3'-конце, которым предшествует последовательность всего праймера из одних V (A или C или G в любой комбинации). В таком случае двум 3'-концевым остаткам AA не найдется комплементарных TT ни в этом же праймере, ни в его партнере из пары. Также неспособными образовывать праймерные димеры будут сходным образом выбранные праймеры с двумя TT на 3'-конце и отсутствием аденинов в остальной части последовательности праймера. Аналогичные варианты с GG и CC на 3'-концах праймеров несколько хуже даже не столько из-за возможных димеров (которых и в этих случаях быть не должно при отсутствии в остальной части праймера цитозинов и гуанинов соответственно), а потому, что GC-последовательности с тремя водородными парами у этих оснований более склонны к фальш-праймированию за счет вероятного отжига на неспецифических участках генома или транскриптома.         Что касается обратно-транскрипционной ПЦР в связи с вопросом образования праймерных димеров, то можно отметить, что остаточная ревертазная активность в реакционной смеси после построения кДНК может способствовать удлинению праймерных димеров, с большей вероятностью возникающих при низкой температуре. О такой опасности предупреждается в ряде работ [Chumakov, 1994; Vandesompele et al., 2002]. Предлагается проводить построение кДНК в отдельной пробирке или удалять фермент депротеинизацией или сильно разбавлять реакционную смесь после построения кДНК.   Пожалуй, самым действенным способом избежать образование и удлинение праймерных димеров является применение в ПЦР так называемого "горячего старта" [Chou et al., 1992], особенно когда на этапе подбора праймеров исключить использование тех, что потенциально способны формировать димерные структуры принципиально не удается. Ранее нами описаны всевозможные варианты "горячего или отложенного старта" в ПЦР [Чемерис и др., 2011] и поэтому здесь повторяться не будем.         Интересным решением исключения образования праймерных димеров являются так называемые кооперативные праймеры, как подсчитано в два с половиной миллиона раз уменьшающие неспецифическую амплификацию [Satterfield, 2014]. Эта работа удостоилась в том же номере журнала комментария известных специалистов в области амплификации, оценивших предложенное новшество [Poritz, Ririe, 2014]. Такие праймеры представляют собой тройную структуру в виде самого праймера относительно малой протяженности (10-12 звеньев), олигонуклеотидной пробы большей длины и разделяющего их этиленгликольного спейсера, причем кооперативные праймеры могут существовать в двух вариантах в виде привычной последовательности 5'к 3', хотя и разделенной внутри спейсером, а также могут иметь два 3'-конца, что достигается путем использования при химическом синтезе разных ("разнонаправленных") фосфорамидитов. Сам по себе праймерный короткий участок отжигаться на матрице при соответствующей температуре не в состоянии и служит затравочной последовательностью только благодаря тому, что более протяженный связывающий участок такого праймера отжигается на матрице недалеко от сайта праймирования фактически внутри будущего ампликона. В процессе роста комплементарной цепи подходящая ДНК полимераза встречает на своем пути эту отжегшуюся связывающую (удерживающую) пробу и в случае обычного варианта праймера синтезированного в направлении 5'к 3' за счет экзонуклеазной активности разрушает это препятствие, а при использовании кооперативного 3'/3' праймера благодаря своей цепь-смещающей активности соответствующая ДНК полимераза удаляет этот участок и в обоих случаях продолжается построение комплементарной цепи далее. Преимуществом такого подхода является то, в следующем цикле ДНК полимераза, пройдя короткий участок настоящего праймера, встречает на своем пути этиленгликольный спейсер, преодолеть который она не в состоянии и синтез на этом останавливается, в результате чего образуется только короткий участок истинного праймера, не способный формировать димерные структуры. Главным же недостатком таких кооперативных праймеров является их высокая стоимость.         Завершая рассмотрение димеров праймеров, пожалуй, надо заметить, что они не всегда играют отрицательную роль. Так сообщается о специальной генерации праймерных димеров и использовании их в качестве внутреннего контроля протекания ПЦР [Leggate, Blais, 2006].   Прежде чем перейти к вопросам термодинамики ДНК и точным расчетам, применяемым при подборе праймеров, следует кратко суммировать главные требования к ожидаемым ампликонам, к местам отжига праймеров и к ним самим, рассматривая некие классические варианты ПЦР, в которых праймеры имеют размеры обычно от 18 до 25 звеньев. Так, в зависимости от задач ампликоны могут иметь разную длину. Что касается амплификации фрагментов ДНК каких-либо генов с целью их последующего клонирования/секвенирования или иного дальнейшего изучения, то в этом случае размер ампликонов, равно как и места отжига праймеров и их последовательности диктуются конкретными обстоятельствами. Для диагностических целей при ведении ПЦР-анализов по конечной точке размеры ампликонов должны обеспечивать легкость детекции с помощью гель-электрофореза или какого иного подхода. Как правило, длина амплифицируемых фрагментов от 100 до 200 п.н. удовлетворяет многим требованиям. Однако при этом надо иметь ввиду, что GC-состав ампликонов желательно, чтобы находился в диапазоне от 40 до 60%, поскольку более GC-богатые участки с большей вероятностью могут формировать различные вторичные структуры, преодолевать которые ДНК полимеразе может быть затруднительно, вследствие чего будет снижаться эффективность ПЦР. Да и места отжига прймеров должны быть лишены вторичной структуры, мешающей спариванию праймера с матрицей. Фрагменты ДНК с излишне высоким содержанием AT-пар также не следует выбирать в качестве мишеней ввиду довольно низкой температуры отжига праймеров, что может с большей вероятностью приводить к фальш-праймированию. Не следует в праймерах (особенно в 3'-области) допускать наличие довольно протяженных гомополимерных участков (например, CCCCC), а также повторяющихся ди-, три-, тетрануклеотидов (например, GAGAGAGA и им подобным), поскольку это может приводить, в том числе к проскальзыванию цепей при репликации. Считается, что если 3'-подпоследовательность праймера будет иметь низкое содержание GC-пар, то в этом случае наработка целевого продукта может быть несколько снижена, тогда как высокое содержание GC-пар в этой области праймера грозит менее специфичным отжигом и как следствие способно привести к ложно-позитивной ПЦР.   Термодинамика ДНК и праймеры  Выбор правильной (оптимальной) температуры отжига праймеров для обеспечения специфичности и эффективности ПЦР крайне важен. В случае применения заниженной температуры возрастает вероятность возникновения ложно-позитивной ПЦР, а при завышенной может иметь место плохая наработка целевых ампликонов, вплоть до их непоявления, что грозит возникновением ложно-негативной ПЦР. Но как же определить эту оптимальную температуру отжига праймеров при проведении ПЦР?  Недавние основательные обзоры, посвященные плавлению ДНК и термодинамике этой молекулы [Privalov, Crane-Robinson, 2018; Vologodskii, Frank-Kamenetskii, 2018], а также отклики на последний [Crane-Robinson, Privalov, 2018; McCauley, Williams, 2018; Owczarzy, 2018; Ritort, 2018; Rouzina, 2018; SantaLucia, 2018; Wartell, 2018] и комментарий самих авторов [Vologodskii, Frank-Kamenetskii, 2018a] показывают, что, несмотря на шесть десятилетий изучения этих вопросов, многое до сих пор остается невыясненным и вклад разных сил в поддержание и формирование двойной спирали ДНК воспринимается неоднозначным и вызывает некоторые споры. К сожалению, во всех этих упомянутых публикациях за пределами рассмотрения остались Хугстиновские пары3, образование при определенных условиях которых может заметно влиять на термодинамику ДНК.  Уникальность молекул ДНК состоит в их способности после произошедшего под влиянием высокой температуры или за счет иных воздействий нарушения двойной спирали при достижении затем подходящих условий восстанавливать свою вторичную структуру, что может быть выражено некой формулой (1)    k           D - Sa + Sb ,  (1) где D - двойная спираль ДНК, Sa и Sb - одиночные комплементарные цепи ДНК, k - коэффициент равновесного состояния, зависящий от многих факторов (температура раствора, концентрация ДНК, pH раствора, вязкость раствора, концентрация солей, присутствие прочих компонентов).  Данные процессы, получившие обозначения "денатурация / ренатурация ДНК" или иначе "переход спираль / клубок", сопровождаются так называемым гиперхромным эффектом, заключающимся в том, что одиночные цепи ДНК в ультрафиолетовом свете поглощают больше, нежели двуцепочечная ДНК, в которой каждый индуцированный светом диполь одного основания взаимодействует с диполем комплементарного ему основания, расположенного в непосредственной близости на другой цепи, и имеющего противоположный ему по направлению дипольный момент. Кривая зависимости поглощения света от температуры называется профилем плавления ДНК, а само плавление есть ничто иное как разрушение (в первую очередь) водородных связей между комплементарными нуклеотидами на противоположных цепях. При этом ДНК в связи с ростом температуры плавится определенными участками с соответствующими данной температуре нуклеотидными составами и доля азотистых оснований, утративших в конкретный момент водородные связи, может быть вычислена по формуле (2)    ?t = At - A0 / A100 - A0, (2) где At - поглощение раствора при конкретной температуре, A0 - поглощение при 0оС, A100 - поглощение при 100оС. Значение 0,5 будет соответствовать температуре, при которой доля разрушенных водородных связей составит половину от возможных и такая температура считается температурой плавления - Tm и может быть выражена также формулой (3)    Tm = ?H/?S - 273.15, (3) где ?H - энтальпия системы, ?S - энтропия системы.  А всю область температур между началом расхождения цепей ДНК и завершением этого процесса называют интервалом плавления. При этом при конкретных температурах (T) имеют место определенные соотношения целых и разорванных водородных связей, соответствующие в данный момент минимуму свободной энергии или иначе энергии Гиббса (?G), образующейся под действием двух противоположных факторов - энтропии и энтальпии системы, что соответствует формуле (4)    ?G = ?H - T?S. (4)  Еще в конце 1950-х гг. была показана линейная зависимость повышения температуры плавления ДНК от увеличения процентного содержания GC-пар у разных видов организмов [Marmur, Doty, 1959]. Позже этим авторам удалось вывести формулу (5) подсчета температуры плавления ДНК, находящейся в растворе, содержащем катион Na+ в концентрации 0,2 М:   Tm = 69,3 + 0,41 • (G-C), (5) где Tm - температура плавления (?С), а G-C - процентное содержание GC-пар в исследуемой ДНК [Marmur, Doty, 1962]. Такой подсчет опирается на различия в числе водородных связей у AT- и GC-пар, при этом считается, что больший стабилизирующий эффект последних вызван не увеличенной энтальпией, а меньшим вкладом энтропии. Позже была предложена другая простая формула (6) для определения температуры плавления молекул ДНК, также учитывающая только нуклеотидный состав, но не его последовательность:    Tm (?С) = 4oC • (C+G) + 2oC • (A+T). (6) Однако данная формула более-менее справедлива лишь для относительно коротких дуплексов (например, до 20 звеньев) и может использоваться для анализа температур плавления праймеров в ПЦР очень ограниченно.   О роли соседних азотистых оснований, участвующих в стэкинг-взаимодействиях, в стабилизации двойной спирали ДНК, в том числе представленной короткими дуплексами, заговорили на рубеже 50-х- 60-х годов прошлого столетия [Hill, 1959; Zimm, 1960; Josse et al., 1961; DeVoe, Tinoco Jr., 1962], что позднее стало рассматриваться как NN-модель (Nearest Neighbor) термодинамического состояния молекул ДНК. Именно наличие стэкинг-взаимодействий между соседними основаниями одной цепи вкупе с водородными связями комплементарных нуклеотидов другой цепи определяет спиральную структуру ДНК и придает молекуле соответствующую прочность. Действительно, если бы не было стэкинг-взаимодействий, то две цепи ДНК напоминали бы болтающуюся веревочную лестницу и подобное же сравнение делает F.Ritort [2018]. В литературе можно встретить высказывания, что вклад стэкинг-взаимодействий в стабильность двойной спирали значительнее, нежели вклад водородных связей между основаниями на противоположных цепях [Vologodskii, Frank-Kamenetskii, 2018].   Имеется немало публикаций, в которых исследовались взаимодействия соседних оснований в различных дуплексах ДНК, включая рестрикционные фрагменты ДНК, сопровождаемые подсчетами свободной энергии в десяти возможных комбинациях динуклеотидов [DeVoe, Tinoco Jr., 1962; Gotoh et al., 1981; Vologodskii et al., 1984; Breslauer et al., 1986; Doctycz et al., 1992]. Несколько позже был произведен улучшенный подсчет этих параметров [SantaLucia Jr. et al., 1996], позволивший затем на основе обобщенных литературных данных выработать унифицированные значения термодинамических параметров динуклеотидов на основе NN модели [SantaLucia Jr. et al., 1998], приведенные в таблице 1.       Таблица 1 Унифицированные термодинамические параметры молекул ДНК с Уотсон-Криковскими парами  на основе NN-модели в 1 M NaCl (по SantaLucia Jr., Hicks, 2004) Table 1. Unified thermodynamic parameters of DNA molecules with Watson-Crick pairs  based on NN-model in 1 M NaCl (by SantaLucia Jr., Hicks, 2004) Соседние динуклеотиды Neighboring dinucleotides ?H (kcal mol?1) ?S ?G37 (kcal mol?1) AA/TT ?7.6 ?21.3 ?1.00 AT/TA ?7.2 ?20.4 ?0.88 TA/AT ?7.2 ?21.3 ?0.58 CA/GT ?8.5 ?22.7 ?1.45 GT/CA ?8.4 ?22.4 ?1.44 CT/GA ?7.8 ?21.0 ?1.28 GA/CT ?8.2 ?22.2 ?1.30 CG/GC ?10.6 ?27.2 ?2.17 GC/CG ?9.8 ?24.4 ?2.24 GG/CC ?8.0 ?19.9 ?1.84    Учитывая важную роль стэкинг-взаимодействий соседних азотистых оснований в стабилизации двойной спирали ДНК, при подборе праймеров необходимо учитывать не просто нуклеотидный состав какого-либо участка ДНК, но и его последовательность, в первую очередь представленность конкретных динуклеотидов, учитывающую их перекрытие. Например, при анализе последовательности GCACTGATCGGCCTAGTG необходимо анализировать все возможные динуклеотиды, а именно - GC, CA, AC, CT, TG, GA, AT и так далее. Имелось даже предложение NN-модель заменить на NNN (Next Nearest Neighbor) модель и принимать в расчет три соседних нуклеотида, однако было показано, что какого-либо серьезного улучшения предсказания термодинамических параметров молекул ДНК это не дает [Owczarzy et al., 1999]. Помимо динуклеотидов следует принимать во внимание еще ряд параметров, которые в той или иной степени включены в алгоритмы поиска и дизайна праймеров, осуществляемых с помощью множества существующих компьютерных программ, о которых речь будет идти дальше.   Предложено довольно большое количество формул для определения температур плавления дуплексов ДНК, применимых, в том числе при определении оптимальных температур отжига праймеров в ПЦР, учитывающие разные составляющие, и часть из них ниже будет приведены.   Tm(oK) = ?H • 1000 / ?S + R • ln(C/F)  Tm(oC) = ?H • 1000 / ?S + R • ln(C/F) - 273,15  Tm(oC) = ?H • 1000 / ?S + R • ln(C/F) - 273,15 + 12.0 • log [Na+], (7)  (8)  (9) где R - газовая постоянная (1,9872 кал/мол); C - концентрация цепей ДНК; F - может принимать разные значения (1 - для самокомплементарных олигонуклеотидов; 4 - для несамокомплементарных дуплексов с равной или близкой концентрацией цепей ДНК; 2 - для цепей ДНК, представленных в разных концентрациях, что в ПЦР соответствует прймерам и матричной ДНК). Существует еще один вариант данной формулы, где для точной концентрации цепей ДНК предлагается производить вычитание из большей меньшую, но при ПЦР такой подсчет особого смысла не имеет, поскольку количество праймеров, берущихся в реакцию составляет около 1012, тогда как число копий анализируемой ДНК (мишеней) обычно составляет от 102 до 105 и ничтожно мало по сравнению с концентрацией праймеров.  Присутствие в реакционной смеси двухвалентных катионов Mg2+ или Mn2+ может учитываться через формулу (10)    Na+ = 4 • (Ka2+)2,  (10) где Ka2+ обозначает двухвалентные катионы Mg2+ или Mn2+.  В ПЦР при отжиге праймеров образуются затравочные комплексы с "висящими" по краям нуклеотидами, принадлежащим исходным матрицам, как это изображено на рис. 1. Данная структура теоретически может иметь место при неоптимальной (заниженной) температуре отжига, допускающей существование неспаренных участков. Вероятность формирования водородных связей у нуклеотида с красным фоном находится под вопросом, поскольку рядом с ним нет соседних спаренных азотистых оснований, с которыми у него могли бы быть стэкинг-взаимодействия. Однако при довольно низкой температуре и в случае нахождения в данном месте GC-пары с тремя водородными связями данная структура все же представляется возможной. Высвеченные зеленым фоном нуклеотиды формируют классическую двойную спираль со всеми присущими им взаимодействиями. Что касается азотистых оснований, высвеченных желтым цветом, то у расположенных внутри праймерной последовательности полноценные стэкинг-взаимодействия имеются только с одним из соседних нуклеотидов и такое может иметь место при неполном спаривании оснований праймера с матрицей. Схожая ситуация в плане ослабления стэкинг-взаимодействий у нуклеотидов, находящихся на 5'- и 3'-концах праймера, с той лишь разницей, что такое является неизбежным при любом отжиге праймера на более длинной матрице и посему были произведены специальные расчеты энергии связей для разных висящих нуклеотидов [Bommarito et al., 2000], приведенные в таблице 2.      Рис. 1. Фрагмент цепи ДНК с отожженным на ней праймером с неспаривающимися нуклеотидами. s - одноцепочечные участки, d - двуцепочечные участки. Вертикальные линии символизируют водородные связи между комплементарными нуклеотидами. Разными цветами в праймере выделены азотистые основания с отличающимися стэкинг-взаимодействиями. Сиреневым цветом в матричной ДНК выделены висящие нуклеотиды, оказывающие заметное влияние на энергию Гиббса крайних нуклеотидов праймера, выделенных желтым цветом. (Дальнейшие пояснения в тексте). Fig. 1. A fragment of a DNA chain with an annealed primer on it with several mismatched nucleotides. s - single-stranded DNA, d - double-stranded DNA. Vertical lines symbolize hydrogen bonds between complementary nucleotides. Nitrogenous bases with different stacking interactions are distinguished by different colors in the primer. The dangling nucleotides painted in the DNA matrice with mauve have a noticeable effect on the Gibbs energy of the primer extreme nucleotides shown in yellow. (Further explanation in the text).  Таблица 2 Основанные на NN-модели параметры энтальпии и свободной энергии системы праймер-матрица, характеризующихся висящими концами в 1 M NaCl. (по SantaLucia Jr., Hicks, 2004) Parameters of Gibbs energy and entalpy based on Nearest-Neighbor model for terminal dangling nucleotides  in 1M NaCl (by SantaLucia Jr., Hicks, 2004) "Висящие" по краям нуклеотиды X = A ?H      ?G37 X = C ?H      ?G37 X = G ?H      ?G37 X = T ?H      ?G37          5  '-висящие концы XA/T 0.20   ?0.51 0.60   ?0.42 ?1.10   ?0.62 ?6.90   ?0.71 XC/G ?6.30   ?0.96 ?4.40   ?0.52 ?5.10   ?0.72 ?4.00   ?0.58 XG/C ?3.70   ?0.58 ?4.00   ?0.34 ?3.90   ?0.56 ?4.90   ?0.61 XT/A ?2.90   ?0.50 ?4.10   ?0.02 ?4.20   0.48 ?0.20   ?0.10          3  '-висящие концы AX/T ?0.50   ?0.12 4.70   0.28 ?4.10   ?0.01 ?3.80   0.13 CX/G ?5.90   ?0.82 ?2.60   ?0.31 ?3.20   ?0.01 ?5.20   ?0.52 GX/C  ?2.10   ?0.92 ?0.20   ?0.23 ?3.90   ?0.44 ?4.40   ?0.35 TX/A ?0.70   ?0.48 4.40   ?0.19 ?1.60   ?0.50 2.90   ?0.29    В ходе ПЦР при использовании ДНК полимераз, обладающих некоей ограниченной нематричной активностью (типа Taq полимеразы), ампликоны также будут иметь на своих 3'-концах по выступающему нуклеотиду (преимущественно аденину), поэтому ситуацию с отжигом праймеров на матрицах с постоянным образованием висящих нуклеотидов на обоих концах можно считать обычным делом.   Применительно к ПЦР точное определение температуры плавления праймера(ов) при его гибридизации с матрицей ДНК крайне важно для выбора оптимальной температуры отжига праймера(ов) для эффективного процесса амплификации. Большинство исследователей предлагают использовать температуру отжига на 5оС ниже температуры плавления, хотя можно встретить и рекомендации по снижению как всего на 2оС, так и на целых 10оС. Однако учитывая довольно большую неопределенность разных параметров, из которых высчитывается температура плавления и дуплексов и праймера с матрицей все же следует признать, что самая оптимальная температура отжига может быть определена лишь в ходе пробных амплификаций, что особенно удобно делать, если использовать ДНК-термоциклеры, позволяющие устанавливать градиент температур в реакционном блоке, что рассмотрено нами ранее [Магданов и др., 2011; Чемерис и др., 2012].   Надо также заметить, что имеется еще целый ряд альтернативных формул подсчета температур плавления (отжига) праймеров в ПЦР, представленных ниже.    Tm = 2 • (L + G + C), (11) где L - длина праймера, G и C - количество гуанинов и цитозинов соответственно,  Ta = 0.3 • Tm (primer) + 0.7 • Tm (product) - 25, (12) и в этом случае необходимо знать нуклеотидную последовательность (нуклеотидный состав) ампликона для того чтобы рассчитать его температуру плавления по формуле (12а)   Tm = 81.5 + 16.6 • (log10[K+]) + 0.41 • (%G+%C) - 675/length, (12а) где length обозначает длину ампликона, которая должна быть (желательно) в пределах от 100 до 600 п.н.        Tm = 81.5 + 16.6 • (log10[Na+]) + 0.41 • (%G+%C) - 500/                primer length - number of mismatches (%), (13) и в последнем случае предполагается, что праймеры могут спариваться с матрицей неполностью, к описанию чего ниже перейдем.   Здесь же надо еще отметить, что добавление в реакционную смесь различных ингредиентов, влияющих на образование водородных связей и соответственно на температуры отжига и плавления праймера с матрицей (например, ДМСО, снижающего эти значения в среднем на 0,75оС на 1% данного соединения, причем независимо от нуклеотидного состава) [von Ahsen et al., 2001], во внимание не приняты, поскольку это тема отдельной статьи.   Вырожденные праймеры  Для обеспечения максимальной специфичности ПЦР требуется, чтобы праймеры были полностью комплементарны местам отжига и не допускали неполного спаривания своих последовательностей с матрицей ДНК или РНК, о чем уже говорилось выше. Однако имеется немало случаев, когда невозможно подобрать последовательность одного или обоих праймеров, которые бы полностью спаривались с мишенью. Одной из причин этого может быть то, что экспериментатору неизвестна нуклеотидная последовательность искомого участка у анализируемого организма. Так, например, предстоит изучить некий относительно консервативный в эволюции ген, который секвенирован у нескольких других близких видов и при сравнении известных нуклеотидных последовательностей этого гена или его фрагмента обнаруживается определенный полиморфизм, выражающийся в заменах ряда или даже большого числа азотистых оснований. Поскольку стоит задача амплифицировать и секвенировать данный ген у нового вида, для которого еще нет такой информации, то при подборе праймеров следует выбирать наиболее консервативные участки, лишенные замен нуклеотидов, фланкирующие полиморфный участок, но в случае принципиальной невозможности этого придется выбирать место для отжига одного или обоих праймеров с минимальным числом замен, соблюдая основное условие по решению стоящей задачи выявления полиморфизма. В этом случае при синтезе соответствующих олигонуклеотидов полиморфные нуклеотиды должны быть представлены в последовательностях праймеров таким образом, что теоретически будут обеспечивать полное спаривание для одной из комбинаций. То есть во время синтеза олигонуклеотидов в определенном положении добавляется смесь фосфорамидитов (например, C и G) и тогда на выходе получится смесь фактически двух праймеров, у части которых будет в нужном положении C, а у других - G. Такие праймеры и называют вырожденными. Другой возможностью составления желаемого пула праймеров может быть независимый синтез разных вариантов олигонуклеотидов, которые потом можно комбинировать в любом соотношении, но в этом случае имеются ограничения ввиду невозможности синтеза очень большого числа вариантов при наличии нескольких замен нуклеотидов в местах отжига праймеров.  Когда неоднозначная информация имеется по большему числу нуклеотидов, то соответственно и синтез должен вестись с учетом этого, что в итоге выльется в еще более вырожденные праймеры, число вариантов которых будет расти в зависимости от таких мест и от выбора для них двух, трех или всех четырех нуклеотидов. Количество комбинаций (вырожденность) такого праймерного пула можно подсчитать, перемножая число возможных нуклеотидов в каждой вариабельной позиции. Так, например, если в некоем вырожденном праймере имеется два вариабельных места, в одном из которых возможно присутствие трех нуклеотидов, а во втором - четырех, то общее число различных праймерных последовательностей в их пуле составит 12 вариантов, что приведет к снижению реальных концентраций разных праймеров в реакционной смеси более чем на порядок. Дальнейшее увеличение числа вариабельных нуклеотидов в таком вырожденном праймере приведет к еще большему снижению концентраций каждого, что при проведении ПЦР может оказаться уже критичным.        При этом за общее правило должно быть принято то, что 3'-область вырожденных праймеров должна быть по возможности лишена вариабельных нуклеотидов. Хотя в отдельных случаях может быть и наоборот. Также рекомендуется первые несколько циклов (до 5) проводить при немного сниженных температурах отжига, повышая вероятность отжига вырожденных праймеров на искомых генах, хотя это может привести к снижению специфичности реакции настолько, что в результате амплификации могут наработаться совсем иные фрагменты ДНК, не имеющие никакого отношения к ожидаемым.        В случае высокого уровня полиморфизма ДНК и как следствие большой вырожденности праймеров в какой-то момент число комбинаций и соответственно вариантов праймеров может стать настолько большим, что будет серьезно влиять на представленность разных типов праймеров в их пуле и соответственно в реакционной смеси, сильно тормозя протекание ПЦР. Решением такой проблемы может быть использование при синтезе вместо отдельных полиморфных нуклеотидов неких универсальных азотистых оснований, готовых спариваться со всеми остальными нуклеотидами. Одним из таких универсальных нуклеотидов служит инозин или точнее дезоксиинозин. Хотя данное азотистое основание все равно характеризуется некой избирательностью связывания и соответственно "выбором" ДНК полимеразой при синтезе комплементарной цепи по такому праймерному участку тех или иных дНТФ. Так, считается, что инозин связывается с прочими нуклеотидами с такой предпочтительностью - I:C -- I:A - I:T = I:G [Martin et al., 1985], что вполне объяснимо, поскольку дезоксиинозин является по сути гуанозином, у которого отсутствует аминогруппа в положении N2 пуринового кольца. Было установлено, что при построении комплементарной цепи против инозинов ДНК полимераза всегда встраивает цитозины [Rossolini et al., 1994]. Спустя много лет, другие авторы, изучая термодинамику спаривания дезоксиинозинов в зависимости от соседних оснований, подтвердили те результаты, указав только, что пара I:C превосходит пару I:A не столь значительно как I:A остальные [Watkins, Jr., SantaLucia, Jr., 2005]. Иными универсальными азотистыми основаниями, используемыми в праймерах, служат 5-нитроиндол и 3-нитропиррол [Loakes, Brown, 1994; Nichols et al., 1994; Loakes et al., 1995]. Так, показано, что добавление на 5'-конец октануклеотидных праймеров 3 или 4 нитроиндолов значительно улучшало результаты секвенирования по Сэнгеру [Ball et al., 1998]. Предлагалось использовать в ПЦР и праймеры с гипоксантином и другими аналогами как пуринов, так и пиримидинов в качестве универсальных азотистых оснований [Lin, Brown, 1992].         Здесь, пожалуй, следует вспомнить одну раннюю работу, в которой для амплификации фрагмента гена крысы использовали вырожденные праймеры, в том числе применив для отдельных сильно вариабельных позиций инозин [Knoth et al., 1988]. Авторы сообщили, что один из их вырожденных праймеров мог связываться с 576 вариантами нуклеотидных последовательностей, а второй - с 1024 потенциальными мишенями. Тем не менее, такая сильная вырожденность праймеров обеспечила специфичную амплификацию, что было подтверждено с помощью блот-гибридизации по Саузерну. Высоко вырожденные праймеры, содержащие как множество инозиновых остатков, способных спариваться с практически любыми основаниями, так и прочие вариабельные позиции, позволили идентифицировать разные штаммы бактерий E.coli [Candrian et al., 1991], а также изучить различные гены суперсемейства цитохрома Р450 [Shen et al., 1993], амплифицировать гены легких и тяжелых цепей иммуноглобулинов мыши, нуклеотидные последовательности которых были неизвестны [Wang et al., 2000]. Показано, что использование при анализе мРНК методом дифференциального дисплея довольно коротких 10-ти звенных праймеров, содержащих множественные инозины в разных местах праймеров, привело к увеличению эффективности амплификации и соответственно к улучшению картины электрофоретического разделения продуктов ПЦР [Rohrwild et al., 1995]. Есть и другие примеры успешного использования инозинов в составе праймеров, что приводило к улучшению амплификации целевых мишеней, тогда как даже единичные неспаренные нуклеотиды в 3'-области обычных праймеров без инозинов в вариабельных местах ухудшали эффективность ПЦР в 100 раз [Cassol et al., 1991].        Для амплификации генов 16S рРНК бактерий предложено использовать общие для всех видов универсальные праймеры, однако, несмотря на высокую эволюционную консервативность этих локусов, чтобы не "пропустить" какие-либо микроорганизмы в ряде работ на 3'-концах праймеров рекомендуют использовать инозины [Ben-Dov et al., 2006; Brands et al., 2010; Ben-Dov, Kushmaro, 2015]. В одной статье продемонстрировано, что использование инозинов в праймерах для амплификации генов 16S рРНК не только на 3'-конце, но и на соседней позиции [Ben-Dov et al., 2011], сделало их фактически более универсальными. Но еще задолго до этого было показано, что использование на 3'-концах праймеров инозинов обеспечивает амплификацию, когда исследуются эволюционно-близкие виды [Batzer et al., 1991].        Другой причиной использования вырожденных праймеров служит необходимость амплификации (например, с целью последующего клонирования) гена некоего белка, для которого известна только аминокислотная последовательность или ее часть [Girgis et al., 1988; Lee et al., 1988]. А поскольку, как известно, генетический код сам характеризуется заметной вырожденностью, то восстановить по аминокислотной последовательности однозначную нуклеотидную практически невозможно. В качестве подтверждения этого можно привести некий условный пептид (начинающийся с типичной стартовой аминокислоты метионина, состоящий из всех аминокислот, приведенных в алфавитном порядке, но с учетом числа кодирующих их триплетов (указанных в верхней строке), и заканчивающийся терминирующим кодоном) и его, с позволения сказать, "ген(ы)" (рис. 2).                  1 1 2 2 2 2 2 2 2 2 2 3 4 4 4 4 4 6 6 6 3 Met Trp Asn Asp Cys Gln Glu His Lys Phe Tyr Ile Ala Gly Pro Thr Val Arg Leu Ser Ter ATG TGG AAC GAC TGC CAA GAA CAC AAA TTC TAC ATA GCA GGA CCA ACA GTA CGA CTA TCA TAA   AAT GAT TGT CAG GAG CAT AAG TTT TAT ATC GCC GGC CCC ACC GTC CGC CTC TCC TAG            ATT GCG GGG CCG ACG GTG CGG CTG TCG TGA             GCT GGT CCT ACT GTT CGT CTT TCT                   AGA TTA AGC                   AGG TTG AGT          Рис. 2. Условный пептид и варианты кодирующих его "генов" с указанием  потриплетно нуклеотидных последовательностей Fig. 2. Hypothetical peptide and variants of encoding its "genes" with indication of triplet nucleotide sequences                     И таких "генов" с уникальными последовательностями, кодирующими один и тот же условный пептид - MetTrpAsnAspCysGlnGluHisLysPheTyrIleAlaGlyProThrValArgLeuSer, может быть без малого 340 миллионов вариантов и это без учета терминирующих кодонов, которые еще в три раза могут увеличить разнообразие этих "генов". Безусловно, при выборе участка белковой последовательности, для которой надо "восстанавливать" кодирующую ее последовательность ДНК, для последующей амплификации и клонирования следует стараться придерживаться тех аминокислот, которые кодируются меньшим числом кодонов. Так, например, используя прямой и обратный праймеры с 4 и 7 остатками инозинов в них, соответствующие каждый 10 аминокислотам NH2- и COOH-концов 2-кето-4-гидрооксиглутарат альдолазы E.coli, удалось амплифицировать фрагмент гена данного белка [Patil, Dekker, 1990]. Наиболее часто инозины в праймерах располагают на месте третьих нуклеотидов в кодонах, но в ряде случаев для вариабельных аминокислот предлагалось триплет целиком составлять из инозинов [Bartl, Weissman, 1994; Liu, Nichols, 1994]. Вырожденные праймеры, отжигающиеся на консервативных участках, могут использоваться для поиска гомологичных генов или генных семейств у того же организма или у разных групп организмов [Lang, Orgogozo, 2011; Iserte et al., 2013]. Но даже, если ограничиться только аминокислотами, кодируемыми двумя триплетами, то, например, для праймера из 21 звена минимальное количество составит 128 комбинаций. Впрочем, чтобы снизить их число следует принимать во внимание предпочтения, оказываемые разными организмами тем или иным триплетам в ходе трансляционного процесса [Campos, Quesada, 2017].   Иной причиной использования вырожденных праймеров является возникающая в ряде случаев (в первую очередь ввиду ограниченного количества доступной для исследования ДНК) необходимость полногеномной амплификации ДНК (WGA - Whole Genome Amplification), одно время преимущественно осуществляемой с помощью ПЦР. И хотя в настоящее время для этой цели используются главным образом другие подходы в виде нескольких изотермических реакций, еще окончательно не сдала свои позиции и ПЦР [Huang et al., 2015]. В одной из ранних работ по амплификации всего генома использовались довольно длинные праймеры (22 звена), особенностью которых было наличие 6N недалеко от 3'-конца (в одном случае, начиная с четвертого, а во втором - с седьмого нуклеотидов), что обеспечивало высокую вырожденность этих праймеров и множество мест их отжига (около 106 для человеческого генома) [Telenius et al., 1992]. Причем в каждом конкретном случае амплификация велась при помощи одного праймера. Немало работ методического плана с целью усовершенствования данного подхода полногеномной амплификации выполнено с использованием праймеров такого типа [Cheung, Nelson, 1996; Barbaux et al., 2001; Bonnette et al., 2009]. В качестве преимущества такого подхода авторы указали на его некую универсальность, поскольку такая амплификация геномов не носит видоспецифичный характер. Еще большее число мест отжига при проведении WGA наблюдалось для полностью вырожденного праймера, представляющего собой на самом деле пул праймеров, длиной 15 звеньев, где в каждой позиции может находиться любое азотистое основание, что составляет свыше миллиарда (415) различных вариантов олигонуклеотидных последовательностей [Arneson et al., 2008].        В качестве некой альтернативы вырожденным праймерам для амплификации множественных участков могут рассматриваться и обычные довольно длинные праймеры, отжиг которых ведется при крайне низкой температуре (на 20-30оС ниже оптимума), что приводит к увеличению числа мест отжига ввиду достаточности энергии связывания такого праймера с матрицей в условиях неполного спаривания. Такой подход получил название LSSP-PCR (Low-Stringency Specific Primer), но его главное предназначение - это все же выявление полиморфизма ДНК [Pena et al., 1994].   Праймеры с экстрапоследовательностями  на 5'-конце  Также более длинные чем обычно праймеры содержат на 5'-конце некие дополнительные последовательности нуклеотидов, некомплементарные мишеням и имеющие разное предназначение. Пожалуй, первыми такими участками явились несущие сайты рестрикционных эндонуклеаз, генерирующих липкие концы, используемые для клонирования ампликонов в подходящих векторах [Mullis et al., 1986; Scharf et al., 1986]. При этом протяженность такой последовательности в довесок к отжигающейся на исходной матрице части праймеров зависит от используемого фермента, поскольку известно, что разные рестрикционные эндонуклеазы для проявления своей активности требуют разного количества таких "экстра"-нуклеотидов по краям их сайтов расщепления [Kaufman, Evans, 1990; Zimmermann et al., 1998]. Другое предназначение сайтов рестрикционных эндонуклеаз в дополнительной последовательности праймеров при проведении ПЦР в режиме реального времени заключается в разобщении красителя и гасителя, "пришитых" к экстрапоследовательности одного из праймеров путем рестрикции ампликонов термостабильной рестриктазой, сайт узнавания которой находится между этими флуорохромами [Cairns et al., 2004]. Также для детекции накопления ампликонов в реальном времени разработан способ, названный DzyNA, основанный на дезоксирибозимном расщеплении химерного ДНК-РНК-ДНК-зонда, несущего в своих ДНК-частях флуоресцентный краситель и его тушитель [Todd et al., 2000]. Принцип метода заключается в том, что праймер, помимо основной затравочной части, несет экстра участок, представляющий антисенс-последовательность дезоксирибозима, которая в ходе амплификации на определенном этапе (после денатурации ампликонов) становится активным дезоксирибозимом и разрушает соответствующий химерный зонд, разобщая находящиеся в нем тушитель и краситель. В ряде других работ образующийся подобным образом в ходе ПЦР функциональный дезоксирибозим проявлял пероксидазную активность и позволял вести колориметрическую детекцию ампликонов [Wang et al., 2017; Kim et al., 2018]. Подобный экстра участок может также служить местом для спаривания универсальной гибридизационной пробы при проведении ПЦР в реальном времени [Whitcombe et al., 1998; Zhang et al., 2003].   В одном из подходов к элиминации праймерных димеров в течение небольшого числа циклов на первом этапе ПЦР в крайне низкой концентрации использовались праймеры, на 5'-концах которых имелись одинаковые дополнительные участки, и уже затем в ходе основной ПЦР на них отжигался один и тот же праймер, последовательность которого, исключающую образование димеров, составить легче [Brownie et al., 1997]. Если выше говорилось о том, что плохо, когда праймеры образуют шпилечные структуры, тем не менее есть случаи, когда это оказывается полезным. Так, специально сконструированные праймеры, на 5'-конец которых добавлен ряд нуклеотидов, комплементарных 3'-концу праймера, образуют довольно прочную шпильку, обеспечивающую проведение ПЦР с улучшенной специфичностью, поскольку такой способ амплификации представляет собой вариант горячего старта [Kaboev et al., 2000]. Для лучшей дискриминации однонуклеотидных замен предложено использовать имеющий своеобразную "зацепку" праймер со шпилечной структурой, двухцепочечный участок в которой замещается конкурирующей цепью анализируемой матрицы ДНК [Byrom et al., 2014].      Для одновременного секвенирования различных ПЦР-продуктов из нескольких образцов необходимо использование так называемых баркодов, представляющих собой уникальные нуклеотидные последовательности на 5'-концах праймеров, по которым можно отличать одни риды (reads) от других. Для подбора таких экстра-последовательностей разработано несколько компьютерных программ дизайна праймеров с баркодами, описанные нами ранее [Чемерис и др., 2016].      Подобные праймеры с экстрапоследовательностями, содержащие обычные азотистые основания, некомплементарные амплифицируемым мишеням (без флуорохромов), модифицированными можно считать условно, поскольку под истинно модифицированными праймерами следует понимать те, что содержат помимо природных нуклеотидов иные соединения разнообразной природы.   Модифицированные праймеры     Модификации праймеров (олигонуклеотидов) могут быть трех типов - с измененными различными способами азотистыми основаниями; с отличающейся углеводной частью; с иной межнуклеотидной связью между соседними основаниями, чем стандартная 5'к 3'-фосфодиэфирная. Места модификаций также могут быть разными - на 5'-конце; на внутренних последовательностях нуклеотидов; на 3'-конце. Причем в одном праймере может быть сразу несколько модификаций разных типов. Некоторые модификации вносятся в праймеры уже постсинтетически, но для такой возможности при синтезе необходимо использовать синтоны, содержащие функциональные группы (амино, тиол, селенол и др.), пригодные затем для пришивки к ним всевозможных желаемых соединений. Существует уже достаточно большой ассортимент продажных фосфорамидитов, несущих разнообразные модификации, включая целый ряд флуоресцентных красителей. Каждый тип модификации праймеров преследует конкретные цели, причем в ряде случаев разные модификации позволяют решать одинаковые задачи. При этом главная цель всех этих модификаций - расширение возможностей ПЦР.   Пожалуй, самой простой постсинтетической модификацией химически синтезированных праймеров можно считать их ферментативное фосфорилирование, осуществляемое с помощью полинуклеотидкиназы фага Т4 в присутствии молекул АТФ, которое необходимо для полноценного лигирования ампликона с векторной молекулой. Использование для такого фосфорилирования молекул АТФ с радиоактивным по гамма-положению фосфором приводит к мечению ампликонов по 5'-концу радионуклидами, что обеспечивало как более высокочувствительную (ранее) детекцию ампликонов [Hayashi et al., 1989], так и их использование в качестве гибридизационных зондов в различных экспериментах. Еще одна ферментативная модификация обычных олигонуклеотидов, но только по их 3'-концу осуществляется терминальной трансферазой в присутствии какого-либо дидезоксинуклеозидтрифосфата или его аналога (кордицепина), однако в этом случае такой олигонуклеотид выступает уже не как настоящий праймер, а как конкурирующий за места отжига и при этом он не удлиняется ДНК полимеразой, а только обеспечивает выявление нужных матриц на фоне избыточных ненужных [Puskas et al., 1994; Atamas et al., 1998]. Впрочем, достигнуть подобный эффект можно проще, вводя во время химического синтеза фосфатную группу на 3'-конец олигонуклеотида. Собственно фосфатную группу можно во время синтеза ввести и на 5'-конец олигонуклеотида и тогда к ферментативному фосфорилированию, когда необходимо наличие такой группы у ампликонов, прибегать нужды не будет.   Весьма часто для модификации олигонуклеотидов применяется биотин, который может располагаться не только на 5'-конце праймера, но и внутри олигонуклеотидной последовательности, что зависит от выбранного варианта синтеза олигонуклеотидов и конкретных фосфорамидитов. Меченные биотином праймеры с помощью магнитных частиц и стрептавидин-биотиновой системы позволяют разделять цепи ДНК, что находит свое применение при проведении твердофазной ПЦР, полуколичественной ПЦР, при секвенировании ДНК [Saiki et al., 1989; Wahlberg et al., 1990; Bengtstrom et al., 1991; Landgraf et al., 1991]. Здесь также можно заметить, что мечение олигонуклеотидов биотином имело место еще до разработки ПЦР [Chollet, Kawashima, 1985].  Широко применяется включение в праймеры различных флуорохромов, тушителей флуоресценции, прочих молекул, позволяющих тем или иным способом детектировать в режиме реального времени нарабатываемые в ПЦР ампликоны. Причем, введение флуорохромов, помимо свечения, может иметь и другие эффекты, в том числе в виде упрочнения дуплексов ДНК, что показано на примере красителей Cy3 и Cy5, расположенных на 5'-конце олигонуклеотидов [Moreira et al., 2005; 2015]. Однако модификации праймеров в виде пришитых к ним флуорохромов это тема отдельной статьи.   Возвращаясь к вопросу молекулярного клонирования продуктов ПЦР следует сказать, что оно имеет свои особенности, рассмотренные нами ранее [Чемерис и др., 2014], причем различные модификации праймеров, помимо упомянутого обычного фосфорилирования, играют в этом процессе немаловажную роль. Целый ряд модификаций направлены на образование выступающих одноцепочечных участков у ампликонов для их как лигазного, так и безлигазного клонирования в подходящих векторах. Причем образование таких участков возможно как на 5'-концах, так и на 3'-концах. Получение ПЦР-продуктов с одноцепочечным участком на 5'-конце, пригодным для лигирования, возможно благодаря использованию праймеров, содержащих непроходимые для ДНК-полимеразы участки. Так, в одной из работ в праймер был помещен названный авторами 2-дезоксинафтозином модифицированный нуклеотид, препятствующий достраиванию цепи ДНК [Newton et al., 1993]. Другими авторами вместо азотистого основания в праймер включался 1,3-пропандиол, также оставляющий одноцепочечный участок в амплифицируемой ДНК, пригодный для безлигазного клонирования ампликонов [Kaluz, Flint, 1994]. Предложено размещать в праймерах тетрагидрофуран, аналогично предотвращающий продвижение ДНК-полимеразы и тем самым генерирующий липкие концы, пригодные для клонирования по сайтам соответствующих рестрикционных эндонуклеаз [Gal et al., 1999; 2000]. Проведение ПЦР с химерными праймерами, включающими по одному или по несколько рибонуклеотидных остатков, при использовании ДНК-полимеразы, не преодолевающей данный барьер, в ходе ПЦР приводит к образованию ампликонов с выступающими 5'-концами [Coljee et al., 2000; Donahue et al., 2002]. Для клонирования продуктов ПЦР путем генерации у ампликонов в ходе ПЦР липких 5'-концов было предложено включать внутрь последовательности прямого и обратного праймеров модифицированное азотистое основание (4-O-(2-(2-нитрофенил)пропил)тимин), спариванию которого и использованию его в качестве матричного нуклеотида при полимеризации в следующем ПЦР-цикле препятствует фотолабильная группировка [Tanaka et al., 2008; Kuzuya et al., 2009].  Использование праймеров, несущих на 5'-концах экстра участок из рибонуклеотидов, позволяет осуществить его достройку с помощью обратной транскриптазы после чего под действием РНКазы Н, разрушающей цепь РНК в ДНК/РНК-гетеродуплексах, можно получить у ампликонов 3'-выступающие концы [Li, Gao, 2007]. Для генерации также выступающих 3'-концов, пригодных для лигирования, предложено удаление единичных рибонуклеотидных остатков в праймерных участках ампликонов с помощью обработки солями редкоземельных металлов лантана La3+ или лютеция Lu3+ [Chen et al., 2002]. При использовании праймеров, несущих остатки дУМФ, удаляемых после амплификации с помощью урацил ДНК-гликозилазы, последующий разрыв цепи ДНК производился под действием разных ферментов - эндонуклеаз IV, V или VIII [Watson, Bennett, 1997; Nour-Eldin et al., 2006; Bitinaite et al., 2007; Geu-Flores et al., 2007] в результате чего формируются 3'-выступающие концы. Наличие инозинов в праймерных последовательностях, например, в третьем положении с 5'-конца позволяет по завершению амплификации с помощью фермента эндонуклеазы V произвести выщепление таких неприродных азотистых оснований, что приводит к образованию также 3'-выступающих концов, пригодных для лигирования и клонирования [Baumann et al., 2013].   Введение остатков инозина в состав олигонуклеотидов при их химическом синтезе привело к изобретению праймеров, названных авторами дуалистическими, представляющими собой некую систему последовательностей в виде относительно короткого участка на 3'-конце из 6-12 нуклеотидов с 40-80% GC-пар, 18-25 нуклеотидами на 5'-конце данного праймера, между которыми располагаются от 3 до 8 инозинов [Chun et al., 2007]. Дуалистические праймеры рассчитаны на увеличение специфичности отжига и исключение построения комплементарных цепей ДНК при наличии неспаренных нуклеотидов, как в 3'- так и в 5'-концевых частях такого олигонуклеотида. Остатки инозина при этом, обладая меньшим сродством к обычным азотистым основаниям при установленной температуре отжига, должны находиться в неспаренном состоянии. Внедрение ряда инозиновых остатков на 5'-конце праймера(ов) способствует выявлению полиморфизма ДНК благодаря тому, что разные варианты ампликонов, нарабатываемых с помощью праймеров, имеющих разную длину, легче разделить гель-электрофорезом, при этом такие экстра-участки праймеров, если бы они состояли из канонических нуклеотидов, то были бы не комплементарны исходной мишени и ухудшали процесс отжига праймеров [Shojo et al., 2015].  В ряде работ не менее десятка различных неприродных азотистых оснований с различным успехом опробовано в составе праймеров при проведении ПЦР [Van Aerschot et al., 1995; Hill et al., 1998; Day et al., 1999]. Помещение термолабильной группировки в виде 4-оксо-1-пентил фосфотриэфира на 3'-конце праймеров позволяет осуществлять горячий старт, востребованный при амплификации сложных матриц [Lebedev et al., 2008].   Присоединение к 5'-концу праймеров полицитидилового хвоста, содержащего от 5 до 20 сульфонированных звеньев цитозиновых остатков, имело целью повысить чувствительность детекции (до 100 раз по сравнению с окрашиванием бромистым этидием) нарабатываемых в ПЦР ампликонов, выявляемых с помощью иммуноблоттинга с моноклональными антителами, узнающими модифицированную таким образом ДНК [Paper et al., 1991; Uchimura et al., 1991]. Схожую детекцию ампликонов путем иммуноблотиинга осуществили другие авторы, применив антитела к хелатной группе в виде 4,7-бис(хлоросульфофенил)-1,10-фенантролин-2,9-бикарбоновой кислоты, обеспечивающей к тому же мечение праймеров таким лантаноидом как Eu3+, что позволяет вести детекцию результатов ПЦР с помощью флуоресцентной спектроскопии с разрешением во времени [Chan et al., 1993]. Ранее аналогичное мечение праймеров для ПЦР с использованием другого хелатного комплекса и детекцией ампликонов в растворе обеспечило повышенную чувствительность благодаря пришивке к 5'-концу олигонуклеотида сразу 11 молекул Eu3+ [Dahlen et al., 1991; Hurskainen et al., 1991].   При формировании цепями ДНК дуплексных структур, удерживаемых возникающими водородными связями между комплементарными азотистыми основаниями, главное противодействие этому процессу оказывают отрицательные заряды остатков фосфорной кислоты, вызывающих отталкивание цепей друг от друга. Для того, чтобы преодолеть такое сопротивление существует несколько успешно работающих подходов, как меняющих конформацию взаимодействующих цепей ДНК, их заряд, так и использующих интеркалирующие молекулы. Таким образом, относительно короткие олигонуклеотиды (8-12 звеньев) могут служить в целом ряде случаев (когда такое необходимо) праймерными молекулами с вполне подходящими для экспериментатора температурами их отжига. Также праймеры с упрочненным связыванием с матрицей могут находить применение при проведении амплификации фрагментов ДНК с очень высоким содержанием AT-пар.   Показано, что такие аналоги аденина и цитозина как 2-аминоаденин и 5-метилцитозин при их включении в состав праймеров обеспечивают эффективную амплификацию благодаря образованию более прочных связей этих оснований с комплементарными им нуклеотидами [Lebedev et al., 1996]. Заметное повышение прочности связывания дуплексов ДНК достигается за счет включения в состав олигонуклеотида трипептида 1,2-дигидро-(3Н)-пиролло[3,2-e]индол-7-карбоксилата (CDPI3), интеркалирующего в малую бороздку ДНК и получившего соответствующее название MGB - Minor Groove Binder [Lukhtanov et al., 1995; Afonina et al., 1997]. Помещение MGB на 5'-конец праймеров не влияло на протекание ПЦР в худшую сторону, но при этом резко повышало температурную устойчивость дуплексов ДНК [Afonina et al., 1997]. Так, было показано, что температура плавления АТ-богатого дуплекса длиной 12 звеньев при добавлении на 5'-конец одной из цепей молекулы MGB повышалась с 39 до 56оС. Еще более сильный сдвиг температуры плавления оказался характерен для гексануклеотида ATAACG, который с тем же MGB плавился уже при 36оС вместо 16оС. При этом считается, что для интеркаляции данного MGB в малую бороздку ДНК как раз необходимо наличие как минимум 6-ти звенного дуплекса [Afonina et al., 1997]. Ранее было показано, что присутствие в растворе свободной молекулы CDPI3 оказывает на плавление дуплексов ДНК крайне незначительное влияние, повышая температуру плавления лишь на 2оС [Lukhtanov et al., 1995].  Другим типом интеркалятора, оказывающим влияние на поведение олигонуклеотидных дуплексов, является ortho-TINA - Twisted Intercalating Nucleic Acid - (R-1-O-[2-(1-пиренилэтинил)фенилметил]глицерин. Так, было обнаружено, что наибольшее увеличение температуры плавления олигонуклеотидов достигается, когда TINA в орто-положении размещается на 5'-конце такого модифицированного олигонуклеотида [Schneider et al., 2011]. Позднее этими же авторами было показано, что TINA-праймеры, модифицированные по 5'-концу, могут быть с успехом использованы в ПЦР, повышая чувствительность и специфичность этой реакции [Schneider et al., 2012].  Также более прочные дуплексы формируются между цепями обычной ДНК и ее рибоаналога, получившего название LNA (Locked Nucleic Acid), в состав которого могут входить любые азотистые основания, представляющие собой 2'-O-4'-C-метилен-?-D-рибофуранозил нуклеотиды [Singh et al., 1998; Vester, Wengel, 2004]. В углеводной части данных нуклеозидов образуется метиленовый мостик между кислородом в положении 2' и углеродом в 4'-положении, в результате чего формируется структура, называемая также замкнутой 3'-эндоконформацией, которая заметно снижает гибкость молекулы за счет чего образуемые ею гетеродуплексы с ДНК имеют более высокую температуру плавления (выше по сравнению с обычной ДНК приблизительно на 2 - 6°С на одно модифицированное основание). Это свойство LNA олигонуклеотидов довольно широко используется при конструировании праймеров для проведения ПЦР в целом ряде случаев, среди которых мультиплексная ПЦР, аллель-специфичная ПЦР и др. Тем более, что все нуклеотиды могут быть представлены в LNA конформации, что позволяет помещать такие модифицированные азотистые основания в любое место олигонуклеотидного праймера. Так, в одной из работ был синтезирован целый набор вариантов праймеров, содержащих в 20-ти звенных праймерах от одного до семи LNA нуклеотидов, распределенных по всей длине, включая их 3'- и 5'-концы [Latorra et al., 2003]. Проведенное исследование показало, что LNA-содержащие праймеры работают в ПЦР лучше, чем их чисто "ДНКовые" варианты, особенно при сниженном количестве Taq полимеразы. Взаимосвязь позиций LNA-модификаций в праймерах с эффективностью амплификации изучалась и в других работах [Levin et al., 2006; Malgoyre et al., 2007; Лиманская и др., 2012]. Благодаря повышенной прочности связывания LNA праймеров с ДНК-матрицей в одной из работ при проведении ПЦР были использованы даже пентамерные праймеры [Sun et al., 2008]. Было также показано, что размещение LNA-модификаций на 3'-конце праймеров в виде одновременно последнего и предпоследнего нуклеотидов не позволяет проявляться экзонуклеазной активности Vent- и Pfu ДНК полимераз, тогда как только одна такая модификация защищала не полностью, и за длительное время приводила к разрушению части данных праймеров [Di Giust, King, 2004]. Помимо LNA-нуклеотидов синтезированы еще и ENA-нуклеотиды, отличие которых заключается в замене метиленового мостика на этиленовый, что также положительно повлияло на дискриминирующую способность таких праймеров (о которой будет говориться ниже) при проведении аллель-специфичной ПЦР [Koizumi et al., 2005; 2005a]. При этом было отмечено, что нахождение ENA-нуклеотида на 3'-конце праймера ингибировало работу ДНК полимеразы, тогда как ENA-нуклеотид в предпоследнем положении обеспечивал специфичность амплификации.   Некоей альтернативой LNA/ENA олигонуклеотидам или олигонуклеотидам с MGB служат ZNA олигонуклеотиды, обозначение которых является сокращением от Zip Nucleic Acid. Такой ZNA олигонуклеотид представляет собой конъюгат обычного олигонуклеотида и олигоспермина [Noir et al., 2008]. При этом повышение температуры плавления ZNA олигонуклеотида прямо зависит от числа находящихся в его составе остатков спермина. Так, для декануклеотида каждая молекула спермина повышает температуру плавления на 6,2оС. Упрочнение дуплексных структур в этом случае объясняется тем, что спермины выступают в качестве олигокатиона, способствующего преодолению отталкивания отрицательно заряженных остатков фосфорной кислоты. Показано, что внедрение на 5'-конец олигонуклеотида олигокатиона в виде остатков спермина не мешает этому конъюгату выполнять праймерные функции и не препятствует протеканию ПЦР [Moreau et al., 2009].   Модификация, призванная защитить праймеры от 3'к 5'-экзонуклеазной активности, присущей некоторым ДНК полимеразам с редактирующей активностью, заключается в замене на 3'-конце праймера обычной фосфодиэфирной связи на фосфотиоатную. За счет этого исключается вероятность фальш-праймирования, поскольку ДНК полимеразы с редактирующей активностью оказываются неспособными удалить у такого тио-праймера неспаренные нуклеотиды на 3'-конце. При этом было показано, что одной такой связи не в полной мере достаточно для ингибирования экзонуклеазной активности Vent ДНК полимеразы и требуется не менее двух данных модификаций [de Noronha, Mullins, 1992]. Хотя в работе другого автора [Skerra, 1992] Pfu полимераза и та же Vent полимераза не проявляли свою экзонуклеазную активность уже при одной фосфотиоатной связи на 3'-конце тио-праймера. Было также обнаружено, что наличие на 3'-конце фосфотиоатной связи не только защищает праймер от деградации под действием экзонуклеазной активности Pfu полимеразы, но и повышает специфичность амплификации, не позволяя идти этому процессу амплификации в случае имеющих место единичных или множественных неспариваний среди первых восьми (с 3'-конца) нуклеотидов праймера [Yang et al., 2005]. Размещение четырех фосфотиоатных связей на 5'-конце одного из праймеров также преследовало цель защитить цепь ДНК от экзонуклеазного расщепления, которое осуществлялось после завершения ПЦР с помощью Т7 экзонуклеазы гена 6, проявляющей гидролитическую активность в направлении 5' к 3' [Nikiforov et al., 1994]. Это имело значение для превращения ампликона в одноцепочечный продукт, который потом легко отделялся от остальных ингредиентов, благодаря тому, что праймер нес на том же 5'-конце еще одну модификацию в виде биотиновой метки.  Одной из модификаций праймеров, о которой уже шла речь выше, является разнонаправленный синтез их отдельных частей и включение в их состав этиленгликольного спейсера [Satterfield, 2014], который можно в некоторой степени считать альтернативой фосфодиэфирной связи между соседними азотистыми основаниями, разделенными таким участком. Интересное применение этиленгликольный спейсер нашел в специальном гибридизационном зонде-праймере Scorpion при проведении ПЦР в реальном времени, не позволяющим ДНК полимеразе использовать в качестве матрицы гибридизационную часть праймера, оставляя ее одноцепочечной [Whitcombe et al., 1999].  Применяемые в ПЦР различные модифицированные праймеры весьма сильно расширяют возможности данного метода, но их главным недостатком является увеличенная, а то и весьма высокая стоимость. Другим моментом, сдерживающим широкое использование модифицированных праймеров (по крайней мере, некоторых типов), служит их ограниченная доступность ввиду относительно малого числа мест, где ведется заказной синтез таких модифицированных олигонуклеотидов. Компания "Синтол" (www.syntol.ru), наряду с обычными олигонуклеотидами, производит синтез модифицированных олигонуклеотидов, ассортимент которых довольно значителен, при этом он включает и часть упомянутых в данной статье.   Дискриминирующие праймеры  Под дискриминирующими праймерами понимаются те, что позволяют выявлять нахождение в конкретном месте цепочки ДНК того или иного нуклеотида, обеспечивая или не обеспечивая амплификацию специфичного участка ДНК. Данный процесс, широко используемый при выявлении однонуклеотидного полиморфизма ДНК, часто называют аллель-специфичной ПЦР [Wu et al., 1989].   Как уже неоднократно отмечалось, наиболее важной областью практически любых праймеров является их 3'-конец, поскольку именно к нему в случае его спаривания с матрицей ДНК полимераза готова присоединять очередные нуклеотиды. Так, в одной работе было показано, что дискриминирующий праймер с неспаренным для обычной ДНК нуклеотидом на 3'-конце позволяет выявить мутацию в присутствии 107 избытка такой ДНК [Ehlen, Dubeau, 1989]. Причем, чтобы детектировать эту мутацию сразу у нескольких генов из суперсемейства генов ras (h-ras, k-ras, n-ras) авторами использовались также прямой и обратный праймеры с 9 и 8 инозинами, включенными в третьи положения кодирующих аминокислоты кодонов данного белка, что подтвердило принципиальную возможность использования таких сильно вырожденных праймеров для детекции мутаций с помощью дискриминирующих праймеров. В работе других авторов было показано, что большей дискриминирующей силой (от 40 до 100 раз) обладают праймеры, в которых на 3'-конце находятся нуклеотиды T, G или C, но не A [Ayyadevara et al., 2000]. В этой же статье сообщается, что от второго нуклеотида с 3'-конца также довольно сильно зависит эффективность ПЦР и дискриминирующая способность праймеров, причем если в этом положении находятся T или особенно А, то процесс амплификации заметно ухудшается.   В одной из работ были исследованы все 12 возможных вариантов неспаривания с матрицами ДНК находящихся на 3'-конце нуклеотидов в праймерах на предмет их удлинения Taq полимеразой [Huang et al., 1992]. Было обнаружено, что варианты транзиций A • C4, C • A, G • T и T • G удлиняются с частотой 10-3 - 10-4 по сравнению с полностью спаренными каноническими вариантами. Еще менее эффективно удлиняются праймеры с трансверсиями T • C и T • T (10-4 - 10-5), трансверсиями A • A, G • A, A • G, G • G, C • C (10-6 и ниже) тогда как трансверсия C • T приводила к наименьшей дискриминирующей способности, удлиняя праймер с частотой 10-2 по сравнению с полностью спаренными нуклеотидами. Довольно незначительное влияние на эффективность амплификации оказывало наличие неспаренных нуклеотидов на 3'-конце праймеров для A\G, G\A и C\C неспариваний, снижающих наработку целевого продукта приблизительно в 100 раз, тогда как A\A неспаривание уменьшало количество итогового ампликона всего лишь в 20 раз [Kwok et al., 1990]. В этой же работе было обнаружено, что даже два соседних неспаренных нуклеотида в виде динуклеотида TT на 3'-конце позволяли идти амплификации. Недавно было продемонстрировано, что наличие дополнительного неспаренного нуклеотида в положение -4 от 3'-конца праймера заметно улучшило эффективность аллель-специфичной ПЦР и позволило назвать ее как DMAS (Double-Mismatch Allele-Specific) [Lefever et al., 2019].  В целом ряде статей различными авторами сообщено о лучшей дискриминирующей способности праймеров, содержащих на 3'-конце LNA или ENA модификации, при проведении аллель-специфичиной ПЦР для выявления однонуклеотидного полиморфизма или отдельных мутаций [Latorra et al., 2003; Koizumi et al., 2005; 2005a; Maertens et al., 2006; Rupp et al., 2006; Nakitandwe et al., 2007]. Повышенной дискриминирующей способностью характеризуются праймеры, несущие на 3'-конце гидрофобную модификацию в виде метоксиметиленовой группы в положении 4-C' [Strerath et al., 2004; 2007; Gaster, Marx, 2005; Kranaster, Marx, 2007]. Ранее этой же группой авторов сообщалось о хорошей дискриминирующей способности праймеров, несущих на 3'-конце в том же положении азотистых оснований винильную группу [Strerath, Marx, 2002]. Показано, что использование праймера с фосфотиоатной связью на 3'-конце вкупе с термостабильной ДНК полимеразой с редактирующей активностью улучшало дискриминирующие возможности данной системы при выявлении однонуклеотидного полиморфизма ДНК [Hu et al., 2007].   Завершая описание дискриминирующих праймеров надо заметить, что использование в аллель-специфичной ПЦР ДНК полимераз с редактирующей активностью может приводить к получению неверных результатов ввиду удаления таких неспариваемых на 3'-концах нуклеотидов.   Компьютерные программы дизайна праймеров  Учитывая крайнюю важность такого компонента ПЦР как праймеры, за годы использования этой реакции написано множество компьютерных программ для подбора праймеров, направленных на решение тех или иных разнообразнейших задач, стоящих перед экспериментаторами. Ранее нами было кратко рассмотрено около полутора сотен таких программ [Чемерис и др., 2016]. Здесь же остановимся лишь на тех программах, которые получили за прошедшее с момента упомянутой публикации время определенное развитие, а также отметим появившиеся новые программные продукты для дизайна праймеров для проведения различных вариантов ПЦР.   Одним из мощных программных продуктов для дизайна праймеров является неоднократно совершенствовавшаяся программа FastPCR. Не стали исключением и последние годы, когда оказались опубликованными несколько статей, описывающие новые присущие ей возможности [Kalendar et al., 2017; 2017a; 2017b]. Так, в настоящее время программа FastPCR позволяет осуществлять дизайн праймеров не только для стандартной ПЦР, но и для мультиплексной, метабисульфитной ПЦР, вырожденной ПЦР, включая использование LNA-аналогов нуклеотидов, ПЦР в реальном времени, ПЦР с последующим безлигазным клонированием множественных фрагментов и др. Помимо праймеров для ПЦР имеется возможность вести дизайн праймеров для новой реакции XCR5 (Xtreme Chain Reaction - https://fluoresentric.com/principal-of-xcr/), которая оценивается как более скоростная альтернатива ПЦР. Хотя это не относится к теме данной статьи, но все же следует заметить, что FastPCR является одной из немногих программ, позволяющих осуществлять дизайн комплекта праймеров для такой изотермической реакции как LAMP (Loop-mediated Isothermal Amplification - http://loopamp.eiken.co.jp/e/lamp/loop.html). Программа FastPCR (http://primerdigital.com/fastpcr.html) может быть доступна пользователю в пробном режиме в течение трех недель.  Другим широко используемым программным продуктом для дизайна праймеров для ПЦР является программа Primer3 (http://primer3.ut.ee), также много раз совершенствовавшаяся в прошлом и существующая еще в варианте Primer3Plus (http://primer3plus.com), позволяющая не только подбирать праймеры заново, в том числе для секвенирования, но и проводить валидацию подобранных ранее. Недавно для нее была написана подпрограмма Primer3_masker, отсекающая повторяющиеся последовательности ДНК в геномах 196 видов организмов из царства, как растений, так и животных [Koressaar et al., 2018], что заметно облегчает и несколько ускоряет подбор успешно работающих праймеров. Основанная на многопараметрическом анализе олигонуклеотидов Primer3 программа PrimerXL (http://www.primerxl.org) несет ряд оптимизированных параметров, включая дизайн праймеров для упоминаемой выше технологии DMAS, разработанной для аллель-специфичной ПЦР [Lefever et al., 2017]. Для работы с программой PrimerXL требуется регистрация.   Развитием программы MSRE-HTPrimer, также основанной на Primer3, стал новый продукт MSP-HTPrimer, находящийся в свободном доступе на сайте https://sourceforge.net/projects/msp-htprimer/ [Pandey et al., 2016]. Главное предназначение этой программы - дизайн праймеров для анализа метилирования цитозиновых остатков в эпигенетических исследованиях. Для подбора праймеров для проведения метабисульфитной ПЦР, метабисульфитного секвенирования, для метилчувствительного высокоточного плавления ампликонов написан, в том числе отечественными авторами, еще целый ряд новых программных продуктов - MethyMer (https://sourceforge.net/projects/methymer/) [Krasnov et al., 2018], Softepigen (www.soft-epigen.com) [Pinzon et al., 2018], CpGPNP http://forensicdna.kr/cpgpnp/) [Park et al., 2018], PrimerSuite (www.primer-suite.com) [Lu et al., 2017], причем последняя программа позволяет осуществлять дизайн праймеров для мультиплексной метабисульфитной ПЦР, а также содержит несколько подпрограмм PrimerDimer, PrimerROC и PrimerPlex [Johnston et al., 2019]. Учитывая растущую в последние годы популярность мультиплексной ПЦР вообще, написана также программа Oli2go (http://oli2go.ait.ac.at) [Hendling et al., 2018], однако описание данных программ и самой мультиплексной ПЦР требует отдельного рассмотрения и здесь им более внимание уделяться не будет, поскольку как уже говорилось выше это тема самостоятельной статьи. Разработан также находящийся в свободном доступе (https://github.com/drmaize/ThermoAlign) многофункциональный программный продукт ThermoAlign, обеспечивающий, в том числе, дизайн праймеров для ресеквенирования ампликонов [Francis et al., 2017].  Ранее написанная программа STITCHER, получила свое развитие, превратившись в версию STITCHER 2.0 [O'Halloran et al., 2017]. Данная программа ориентирована на проведение ПЦР с перекрывающимися праймерами, "сшитыми" с различными участками, расположенными на их 5'-конце. При этом такие дополнительные последовательности могут быть добавлены самим экспериментатором или выбраны из небольшой встроенной базы данных, где содержится информация о последовательностях адапторов для полногеномного секвенирования на платформе Illumina, а также генов маркерных белков GFP, YFP. Программа STITCHER 2.0 доступна для работы на сайте http://ohalloranlab.net/STITCHER_2_0/index.html. Новая программа Primer Spanner (http://ps.biocloud.org.cn) обеспечивает подбор праймеров для сайт-направленного мутагенеза как в режиме получения единичных мутаций, так и множественных [Hou et al., 2018].   Растет число задач по выявлению и количественной оценке микроРНК, решить которые помогает специализированная программа подбора праймеров miPrimer [Kang et al., 2018]. В созданной базе данных sRNAPrimerDB (www.srnaprimerdb.com) содержится информация о более чем трех миллионах праймеров, предназначенных для детекции малых некодирующих РНК для различных организмов, относящихся к 223 видам [Xie et al., 2018]. Другую узкую цель преследует программа MIPE (MIcrobiota metagenome Primer Explorer), ориентированная на дизайн так называемых SSU праймеров для амплификации генов малой рибосомной РНК при метагеномных исследованиях микроорганизмов [Zou et al., 2017]. Данный программный продукт находится в свободном доступе (https://github.com/zoubinok/MIPE). Еще одна база данных MRPrimer (http://mrprimerv.com) содержит пары праймеров, подобранные для амплификации 7144 кодирующих участков у 1818 различных вирусов [Kim et al., 2017].   Заключение  Из изложенного выше можно видеть, что разнообразие праймеров, используемых для проведения ПЦР со всеми ее многочисленными вариациями, действительно велико. При этом праймеры, являющиеся важнейшим компонентом ПЦР, благодаря такому разнообразию, заметно увеличивают возможности этой реакции амплификации нуклеиновых кислот, влияя на разные стороны этого процесса, главными из которых является специфичность и эффективность. Однако внимательный анализ литературы о праймерах для ПЦР показывает подчас диаметрально противоположные оценки влияния праймерных подпоследовательностей и отдельных нуклеотидов на 3'-конце и на специфичность, и на эффективность ПЦР. Причины тому лежат в первую очередь в огромном разнообразии нуклеотидных последовательностей6, которые приходится амплифицировать и в практической невозможности единой стандартизации условий реакции7. Так, в одной из работ оптимальный выбор праймеров и успешность протекания ПЦР предлагалось оценивать даже по 27 параметрам [Benita et al., 2003]. Тем не менее, более сжатые общие требования к дизайну праймеров для ПЦР, ставя на первое место специфичность процесса, все же можно определить как следующие. Наиболее оптимальными длинами праймеров следует считать имеющие от 18 до 258 звеньев со средним GC-составом от 40 до 60%9. Причем для лучшей специфичности амплификации в некоторый ущерб эффективности реакции праймерам желательно иметь более богатую GC-подпоследовательность на 5'-конце и обогащенную AT-нуклеотидами на 3'-конце.   Помимо длины праймеров важная роль в специфичности ПЦР принадлежит устанавливаемой температуре отжига праймеров, для чего необходимо знать температуру плавления образуемых ими дуплексов с матрицей ДНК. Однако взгляды исследователей на подсчет такой температуры несколько различаются, что дает заметные разночтения при дизайне праймеров с помощью компьютерных программ, использующих разные алгоритмы и разные формулы. Да, и знание "точной" температуры плавления дуплексов не обеспечивает выбор оптимальной температуры отжига праймеров, поскольку в литературе можно встретить рекомендации по снижению таковой от температуры плавления на 2 - 10оС, хотя чаще всего выбирают среднее значение - на 5оС ниже. Поэтому, помимо определения расчетным путем температур отжига, можно рекомендовать экспериментальное установление их оптимума, используя отличающиеся температуры отжига, что в некоторых моделях ДНК-термоциклеров можно осуществить в ходе одной амплификации за счет устанавливаемого градиента температур в термоблоке. При этом, безусловно, надо принимать во внимание масштаб последующих амплификаций, которые могут быть ограничены либо единичными экспериментами для секвенирования и/или клонирования ампликонов (где не столь важна эффективность как специфичность реакции), либо они будут носить массовый характер и тогда должен быть достигнут определенный баланс между специфичностью и эффективностью такой ПЦР. В этом случае возможно потребуется использование горячего старта и прочие ухищрения для улучшения ПЦР. Впрочем, и для единичных экспериментов при подборе праймеров "по месту" для клонирования и секвенирования ПЦР-продуктов горячий старт может также весьма пригодиться.   Нельзя недооценивать вероятность образования праймерных димеров и их вредоносность для ПЦР, о чем уже говорилось в соответствующем разделе данной статьи. Хотя горячий или отложенный старт в большинстве случаев позволит их исключить, необходимо помнить, что праймерные димеры могут приводить как к ложно-позитивным, так и к ложно-негативным результатам. Причем последние даже опаснее, поскольку появление иного ампликона, чем ожидаемый продукт можно довольно легко установить или разделением гель-электрофорезом или плавлением в ДНК-термоциклере, работающим в режиме реального времени, тогда как непрохождение ПЦР может иметь различные причины и их надо все проверять фактически отдельно.   Для расширения возможностей ПЦР и обеспечения более достоверного достижения намеченных результатов необходимо, невзирая на высокую стоимость, все же активнее использовать различные модифицированные праймеры. Что касается компьютерных программ дизайна праймеров для ПЦР, то таковых существует уже более полутора сотен и можно не сомневаться что продолжится как написание новых, так и совершенствование некоторых написанных ранее, что позволит более точно устанавливать температуры плавления/отжига праймеров, поскольку еще до экспериментального их определения необходимо подбирать праймерные последовательности, имеющие близкие температуры и только затем заказывать их синтез, который может через некоторое время, помимо химического, стать и ферментативным.       Интерес к данной тематике вызван проводимыми исследованиями по темам госзадания №№ АААА-А16-116020350028-4, АААА-А16-116020350032-1, AAAA-A19-119021190011-0, а также по гранту РФФИ-Поволжье № 17-44-020120 р_а.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз