Влияние SYBR Green I на протекание изотермической амплификации с помощью ДНК полимеразы Bst exo

Авторы:
Гильванов А.Р. , Сахабутдинова А.Р. , Чемерис А.В. , Гарафутдинов Р.Р.
Название:
Влияние SYBR Green I на протекание изотермической амплификации с помощью ДНК полимеразы Bst exo
Страницы:
268-273
скачано
20 раз(а)


Амплификация нуклеиновых кислот имеет большое значение в исследованиях генома и ДНК-диагностике. Ее осуществляют различными методами, в первую очередь с помощью полимеразной цепной реакции. В последнее время все большее распространение получают изотермические методы, например, амплификация катящимся кольцом, для проведения которых используют ДНК полимеразы с цепь-смещающей активностью. Среди последних наиболее популярна ДНК полимераза Bst, однако для нее характерно образование неспецифических продуктов. В данной работе изучено влияние интеркалирующего красителя SYBR Green I на образование специфических и неспецифических продуктов в реакции амплификации по типу катящегося кольца с помощью большого фрагмента ДНК полимеразы Bst (Bst exo-). Определены концентрации SYBR Green I, полностью ингибирующие образование мультимерных продуктов на линейных матрицах и практически не влияющие на амплификацию кольцевых матриц.
Амплификация нуклеиновых кислот является важным инструментом в современных научных исследованиях, медицинской диагностике и криминалистике [Deng et al., 2015; van Oorschot, 2010]. Из всех методов амплификации, наибольшее распространение получила полимеразная цепная реакция (ПЦР) и ее разновидности. Альтернативой ПЦР являются изотермические методы амплификации, не только обладающие большей чувствительностью и специфичностью, но и не требующие дорогостоящего специального оборудования для термоциклирования [Fakkrudin et al., 2013; Zhao et al., 2015]. Среди таких методов особое место занимает амплификация катящимся кольцом - АКК (rolling circle amplification - RCA) [Ali et al., 2014]. В ходе АКК полимераза добавляет нуклеотиды к растущей цепи, получаемой после отжига затравочного праймера на кольцевой матрице, смещая встречающуюся ей старую цепь, что приводит к образованию одноцепочечной НК в несколько десятков и даже сотен тандемных повторов.
Все изотермические методы амплификации требуют применения полимераз с цепь-смещающей активностью. К ним относятся: фрагмент Кленова, phi29, Vent exo-, Bst exo- и другие. Полимеразы группы Bst exo- применяются наиболее часто ввиду наличия сильной цепь-смещающей активности, высокой процессивности и относительной термостабильности. Однако, Bst полимераза в условиях реакций изотермической амплифликации часто дает неспецифичные продукты: при использовании линейной матрицы и двух праймеров к ней происходит мультимеризация, заключающаяся в образовании набора конкатемерных продуктов, представляющих собой тандемно расположенные повторы нуклеотидной последовательности матрицы, а их образование носит, вероятнее всего, случайный характер [Hafner et al., 2001; Wang et al., 2017]. Эта особенность может приводить к получению ложноположительных результатов, что крайне критично для диагностических исследований.
Известно, что интеркалирующие красители, в частности SYBR Green I, в той или иной степени ингибируют амплификацию нуклеиновых кислот, и эффективность ингибирования зависит от концентрации красителя. Ингибирование было показано для ПЦР [Monis et al., 2005; Gudnason et. al, 2007], в то время как для изотермической амплификации таких данных до сих пор нет. В связи с этим нами было изучено влияние интеркалирующего красителя SYBR Green I на протекание реакции амплификации катящимся кольцом и побочного ему процесса мультимеризации, а также осуществлен поиск концентрации SYBR Green I, при которой ингибированию подвергался бы только процесс мультимеризации ДНК в присутствии полимераз Bst exo-.
Материалами для исследования служили: Bst полимеразы (Bst LF, Bst 2.0, Bst 3.0), поставляемые с ними буферные системы (Thermopol, Isothermal, Isothermal II соответственно) (New England Biolabs, США); интеркалирующий краситель SYBR Green I (Lumiprobe, Россия); искусственная олигонуклеотидная матрица ML и соответствующая ей пара праймеров. Последовательности олигонуклеотидов приведены в таблице 1.
Таблица 1.
Последовательности матрицы и пары праймеров, использованных в работе
Table 1. The sequences of used template and primers
Шифр
Codename
Нуклеотидная последовательность, 5'-3'
Nucleotide sequence, 5'-3'
Длина, нт
Length, nt
ML
CCTCTTGCTTTCGCTCTCGTTCTTTACAGAACACAGACGAGAAGAAGACCA
51
F
CCTCTTGCTTTCGCTCTCGTTCTTT
25
R
TGGTCTTCTTCTCGTCTGTGTTCTGT
26
Кольцевую матрицу MC получали из линейной ML по методике безматричного лигирования, описанной ранее [Сахабутдинова и др. (Sakhabutdinova et al.), 2017]. Препарат ДНК после лигирования подвергали обработке нуклеазой Exo I для удаления линейных одноцепочечных продуктов лигирования и исходных матриц. Амплификацию проводили в реальном времени и с регистрацией результатов по конечной точке методом гель-электрофореза в 10% полиакриламидном геле. Протокол амплификации состоял из следующих этапов: 1) условная "денатурация" при 70°С - 30 с; 2) условный "отжиг" при 65°С - 60 с; 3) элонгация при 60°С - 3 ч (для амплификации в реальном времени) или 2 ч (для амплификации с детекцией результатов по конечной точке. Схема экспериментов представлена на рисунке 1.
Рис. 1. Схема получения кольцевой ДНК матрицы из линейной и их амплификации
Fig. 1. The scheme of circular DNA template synthesis from the linear one, and their amplification
Для работы нами была синтезирована искусственная матрица ML, длиной 51 нуклеотид и соответствующие ей праймеры F и R. В случае линейной матрицы, праймер R отжигается на 3'-конце матрицы и является затравочным. Праймер F отжигается на второй цепи - продукте удлинения праймера R. В результате реакции образуются мультимеры - продукты, имеющие длину, кратную длине исходной матрицы (рис. 1). Согласно результатам китайских исследователей [Wang et al., 2017], образование мультимерных продуктов на линейной матрице связано с "проскальзыванием" полимеразы по циклической структуре, образуемой самой матрицей в ходе реакции, т.е. создается подобие системы с кольцевой матрицей. Данный процесс носит случайный характер, тогда как амплификация на кольцевой матрице проходит неизменно, при условии правильно подобранной системы.
На кольцевой матрице также отжигается затравочный праймер R, в ходе удлинения которого образуется одноцепоченый продукт, содержащий многократно повторяющуюся последовательность, комплементарную матрице, и множество сайтов отжига для праймера F. В результате образуется множество конкатемерных продуктов, имеющих длины, кратные длине исходной матрицы (рис. 1).
Как мультимеры, так и конкатемеры проявляются на электрофореграмме в виде лестницы, состоящей из набора продуктов с кратной исходной матрице длиной. Дифференциация продуктов реакции не представляется возможной ни в случае с отслеживанием хода процесса в реальном времени, ни в случае регистрации по конечной точке. Этот факт, в совокупности со случайным характером мультимеризации на линейной матрице, приводит к получению ложноположительных результатов анализа, что делает актуальным поиск таких условий реакции, при которых ингибируется образование мультимеров, а амплификация на кольцевой матрице проходит с высокой эффективностью. Так как SYBR Green I способен оказывать ингибирующее воздействие на ПЦР (см. выше), нами было выдвинуто предположение, что определенная концентрация красителя может подавить процесс мультимеризации.
Стоковые растворы SYBR Green I для ПЦР в реальном времени, поставляемые различными производителями, имеют концентрацию 100--10000-. По умолчанию экспериментаторы используют в ПЦР смеси концентрацию 1-. Однако, нами было обнаружено, что амплификация линейной матрицы ML в изотермических условиях с полимеразами Bst LF и Bst 2.0 не протекает при рекомендуемой концентрации (1-). В связи с этим, с целью установления оптимальной концентрации красителя, нами был проведен ряд амплификаций в системе, содержащей, помимо ML, и кольцевую матрицу MC, а также Bst LF и разное количество SYBR Green I: 0.1-, 0.25-, 0.5-, 0.75-, 1-, 2-, 3-, 4-, 5-.
Установлено, что АКК (с матрицей MC) для полимераз Bst LF и Bst 2.0 идет только при концентрациях 0.1- и 0.25-, от 0.5- и выше происходит ингибирование процесса (табл. 2). При более низких концентрациях SYBR Green I (0.075x и 0.05x) уровень флуоресценции был недостаточно высоким для проведения анализа (данные не приведены). В то же время для линейной матрицы ML мультимеризация наблюдалась только при концентрации красителя 0.1x, при более высоких концентрациях образование мультимеров не происходило. Таким образом, оптимальной концентрацией SYBR Green I для системы с Bst LF, позволяющей проводить амплификацию катящимся кольцом без образования мультимеров на линейной матрице, является 0.25x.
Таблица 2.
Средние значения порогового цикла Ct (мин)
Table 2. Threshold cycle Ct mean (min)
Полимераза
Polymerase
Тип матрицы
Template type
Концентрация SYBR Green I
SYBR Green I concentration
0.1x
0.25x
0.5x
0.75x
1x
2x
3x
4x
5x
Bst LF
Линейная
Linear
136.7±0.5
-
Кольцевая
Circular
20.0±1.0
31.1±1.9
Bst 2.0
134.6±0.7
22.0±2.0
29.8±1.2
Bst 3.0
91.1±5.1
90.8±4.6
102.8±2.5
109.4±3.5
161.1±1.9
26.7±0.0
26.7±0.5
26.7±0.3
30.0±3.3
33.3±0.7
Полимераза Bst 2.0 ведет себя схожим с Bst LF образом. При концентрации 0.1x происходит как мультимеризация на линейной матрице, так и образование конкатемерных продуктов на кольцевой. При концентрации 0.25x наблюдается образование продуктов только на кольцевой матрице, а при более высоких концентрациях (0.5x, 0.75x, и 1x) ингибируются оба процесса (таблица 2).
В случае полимеразы Bst 3.0, наработка как специфических, так и неспецифических продуктов возможна и при концентрациях SYBR Green I выше 0.25x. Так, наработка продуктов мультимеризации наблюдается даже при концентрации SYBR Green I равной 1x. Однако разница во времени, необходимом для образования специфических и неспецифических продуктов при данных условиях амплификации достаточно велика, что позволяет использовать концентрацию 1x в работе. При концентрациях SYBR Green I не менее 2x происходит полное ингибирование образования продуктов как на кольцевой, так и на линейной матрицах.
Таким образом, оптимальными концентрациями SYBR Green I, при которых происходит значительное ингибирование процесса мультимеризации на линейной матрице и не оказывающими существенного влияния на амплификацию на кольцевой матрице, являются: 0.25x - для Bst LF и Bst 2.0, 1x - для Bst 3.0. Применение реакционных смесей с данными концентрациями SYBR Green I при работе с полимеразами группы Bst exo- позволит избежать получения ложноположительных результатов, вызванных мультимеризацией линейных ДНК матриц, что особенно важно для работы с нуклеиновыми кислотами, выделенными из биоматериалов.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз