Метагеномый анализ последовательностей вирусов РНК - является ли это панацеей для быстрого поиска эффективных праймеров для вирусной диагностики

Авторы:
Калашников А.Е. , Гладырь Е.А.
Название:
Метагеномый анализ последовательностей вирусов РНК - является ли это панацеей для быстрого поиска эффективных праймеров для вирусной диагностики
Страницы:
384-388
скачано
14 раз(а)


В настоящей работе мы описали новый метод геномики
который включает фильтрацию данных и окончательную подготовку вирусных консенсусных последовательностей для анализа. Поэтому результаты могут использоваться и для расчета праймеров с целью обнаружения вирусов. Этот метод позволяет проводить одновременный и одномоментный анализ множества последовательностей для получения информации об изменчивости в каждом сайте на уровне целого генома или при работе с наиболее полном консенсусом - на уровне популяции вирусов. Мы приводим два примера для диагностики РНК-вирусов
заражающих пчел
и вируса крупного рогатого скота
которые мы успешно протестировали на биологических образцах
собранных в России.
Introduction
Currently
actively developing information technologies (IT) are used to solve some important problems in the field of genetics of viruses and their molecular diagnostics. Among the tasks
there are sequence analysis of nucleotides or proteins
detection of conserved and variable regions
and the thermodynamic and other factor analysis. These tasks could be components of IT pipelines allowing the selection of specific oligonucleotides and fluorescent probes to specific regions of the viral genomes [Barnes
2007].
We selected two viral systems: i) Bovine leukemia virus (BLV)
which causes a highly contagious infection that occurs in a latent form
that is striking in a number of key species of farm animals and represents a high risk [Rola-Łuszczak et al.
2013] and ii) genetic variants of honeybee viruses
which include the Kashmir bee virus (KBV)
Acute bee paralysis virus (ABPV)
Chronic bee paralysis virus (CBPV)
Deformed bee virus (DWV)
Sacbrood bee virus (SBV)
Israel acute paralysis virus (IAPV)
Black queen cell virus (BQCV)
Slow paralysis virus (SPV). The infection with these viruses is a highly contagious for honeybees. The infection occurs in a latent form in the entire bee colony [Berenyi et al.
2006; DeMiranda
Genersch
2010]. For effective control of infection
it is necessary to develop new modern diagnostic techniques. Diagnosis with classical methods such as ELISA and RID cannot provide sufficient analytical sensitivity and reliability [Rola-Łuszczak et al.
2013].
Materials and Methods
Objects
For the BLV viral system
65 blood samples from the infected animals of black-pied cattle breed were collected from farms of the Moscow region of Russia. For genetic variants of honeybee viruses
a total of 270 adult bees from 90 bee colonies were collected from tick-borne defeat apiaries in the Ryazan region of Russia.
DNA and RNA isolation
For the nucleic acids isolation we used “Amplisens DNA-sorb-B” DNA isolation Kit (Central Research Institute of Epidemiology
Russia)
“Amplisens RIBO-zol-B” RNA isolation Kit (Central Research Institute of Epidemiology
Russia)
0.5M Na2EDTA
pH 8.0 (Amresco
USA)
buffer 1 (see Note 1)
buffer 2 (see Note 2).
Reverse transcription and real-time RT-PCR
For the reaction of reverse transcription we used “MMLV RT kit” (Evrogen)
“qPCRmix-HS SYBR kit”
“qPCRmix-HS kit” (Evrogen
Russia)
agarose electrophoresis grade (Lonza
Switzerland-USA)
10 mg/ml ethidium bromide Biotechnology Grade (Amresco
USA)
100+ bp ladder (Evrogen
Russia).
Primers and probes for detection of virus-infected Apis mellifera and BLV detections (all in 5’→3’ direction)
Primers and fluorescent probes were synthesized by the Eurogen (Russia). Primer sequences for bee virus detection and reference genes:
ABPV (amplicon size 157 bp):
Forward TCAACCAGGCTATAACCAAC
Reverse TCTTGAAAATGCTTCACCAA
BQCV (amplicon size 130 bp):
Forward CCGTTAGTCCTCAACAGACT
Reverse AAACATGGAGCATAGTACGG
CBPV (amplicon size 177 bp):
Forward ATTGTGAAGCCCAAAACCTG
Reverse GAACCGCTTCGGTGGTAATA
KBV (amplicon size 153 bp):
Forward GCAAATTGATGCTCCTAATG
Reverse TCATAGTCTAATGGGGCAAG
DWV (amplicon size 204 bp):
Forward ATATGCTTTTCCAGGTCCAT
Reverse CTCGCTTCTTCTCTTCACTC
SBV (amplicon size 186 bp):
Forward GGTGACCTTCATCCAGTATC
Reverse GGGTTTCATTTTCGATAACC
IAPV (amplicon size 105 bp):
Forward AGATGTAAGCATGCAGATCC
Reverse CTGAGATCTTCAGGACCAAA
SPV (amplicon size 201 bp):
Forward GTGGGCTGATAGGATGTTAC
Reverse ATCAATGTTATGCGTGGAAG
ACTB [Chen et al
2005] (amplicon size 182 bp):
Forward AGGAATGGAAGCTTGCGGTA
Reverse AATTTTCATGGTGGATGGTGC
Primer sequences for detection of (BLV) and reference genes:
gene ACTB (amplicon size 193 bp):
Forward TGTTACAGGAAGTCCTTTGC
Reverse TGGCTGTCCATTCAAAATAA
Probe: FAM-AGGTGATCGCTTTTGTGTAA-BHQ1
gene GAPDH (amplicon size 212 bp):
Forward GACCACTTTGTCAAGCTCAT
Reverse GATGGAAACATGTGGAAGTC
Probe: FAM-AGAGGAAGAGTTCCTCAGCT-BHQ1
gene GAG (amplicon size 199 bp):
Forward TCTTAGAAGTCAATATCAAA
Reverse ATAACTAAGGGAGTCAATAA
Probe: R6G-CTCCCTACTCGTCCTTCAGT-BHQ1
gene ENV (amplicon size 137 bp):
Forward CCCTTTCAGAATTCGAGCTG
Reverse CTGTAAGGCCTGAGGACTGG
Probe: Cy5-CGCGATCGACCTATTCCTAA-BHQ2
Software for primer selection
For primer calculation and selection we used the following software:
Ugene (ugene.net);
ClustalX (ClustalO) (http://www.ebi.ac.uk/Tools/msa/clustalo/);
Muscle (http://www.ebi.ac.uk/Tools/msa/muscle/);
Primer3 (http://primer3.sourceforge.net/releases.php);
Primer3Plus (http://primer3plus.com/);
UnaFold (http://unafold.rna.albany.edu/);
Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).
Equipment
In the experiments for nucleic acids isolation
amplification and reverse transcription has been used Vortex V-3 (Elmi
Latvia)
Centrifuge 5424R (Eppendorf
Germany) with 45-position rotor
Vacuum pump (Russia)
Laminar sterile box BMB-II-S (Laminar Systems
Russia)
Spectrofotometer Novaspec Plus Visible (Amersham Biosciences
Sweden)
DNA thermocycler CFX Touch with CFX Manager version 3.1 (Bio-Rad Laboratories
USA)
Gel scanning system BDA BRD5 (Biometra
Germany).
Methods for assembling PCR reactions
as well as amplification parameters
will be described below
together with a discussion of choosing experimental conditions in the chapter of the Results and Discussion.
Results and Discussion
Algorithm for analysis of bees Apis mellifera infected with RNA-containing viruses
The test assays appeared more effective than previously developed for the detection of bee viruses COLOSS (www.coloss.org)
detected 20-85% of positive specimens. The average frequency of the proviral DNA and RNA of DWV were not less than 75% and for CBPV more than 80%. The identified range of the relative concentration of RNA ranged from 1.14±0.689*10 2 to 5.41±2.08*10 1. The identified range of the relative concentration of proviral DNA of bees ranged from 6.41±2.23*10 6 to 3.95±1.50*10 2 at a frequency of 0.2 to 0.9. The active form of the virus was detected in the prevailing number of bee colonies and with greater concentrations.
The metagenomic search and analysis of nucleotide sequences of viruses (N>650 of nucleotide sequences which was included in GenBank database) were performed in the program Ugene 1.11.3 (see Note 3)
by using algorithms ClustalX (see Note 4) and Muscle (see Notes 5
6) [1
2]. The differences for the better between the new and previous methods are methods used in this work. This methods were that the nucleotide sequences have been filtered according to the maximum differences by geographic origins of isolating
as well as the maximum genetic subdivision in population.
For each virus there were identified several areas with low frequency of mutations. This areas were used for the design of primers and probes using Primer3 or Primer3Plus includes WEB-online or offline version of programs (parameters: “qPCR” (for bee viruses) or “probe” for BLV) (see Note 7). The specificity of all variants of the oligonucleotides for BLV and bee viruses detection in the system of scoring matches has been verified in the BLAST-score system and on clinical sample test. Minimum 15-35 variants of primer pairs for one target was assembled from BLAST for the synthesis of BLV and bee viruses (data not shown)
for all targets
for all situations) was calculated (see Note 8). The number of matches was calculated in PrimerBlast without replacements in PrimerBlast
divided into the total number of matches (BSc) (Table 1). The final variant of primers and (or) probes is indicated in the table. For each of these options
there were at least 3-7 variants of the tested primer pairs (the results of testing them are not shown). For all pairs of primers
PCR was carried out under various conditions of optimization
according to the PCR guide Bio-Rad and Applay-Biosystems
melting the amplification products in the presence of the intercalating dye.(Real-Time PCR Applications Guide – Gene-Quantification
Bio-Rad
Real-time PCR handbook – Gene-Quantification
Applied Biosystems).
Table 1.
The primer sequences and PCR conditions
for bee virus detections
NosVirus nameTa
0СTm
0СBSc
1ABPV54.777.51.10
2BQCV54.084.53.03
3CBPV56.872-851.50
4KBV56.882.01.11
5DWV55.080.41.18
6SBV54.776.02.39
7IAPV56.475.02.58
8SPV56.475.04.00
9ActB [Chen  et al.
2005]55-65
opt 5980.50.507
Proviral DNA isolation from adult bees was carried out individually. DNA and RNA concentration was measured using a spectrophotometer. The reverse transcription was performed using “MMLV RT kit” with the amount the enzyme equal to 50 U/reaction. The concentration of primers for the amplification of the reference and target genes was 100 nM
and 200 pmol respectively. The temperature of a specific DNA product melting was determined by SYBR fluorescence detection  (see Table 1).
The amplification of bee viruses targets was performed for proviral DNA and RNA of Apis mellifera and BLV viruses in active form (after the reverse transcription step). Detection of fluorescence for SYBR or TaqMan probes was performed starting from the formation temperature of the product in the calculated melting temperature. Amplification was performed by using the algorithm with the time of primer annealing and product elongation of 30 and 45 seconds respectively (40 cycles) using the “SYBR qPCRmix-HS kit”.
The average value of the relative amount of viral RNA and integrated proviral DNA was calculated using the Bio-Rad user manual [Mackay
2002]. Appropriate tests have been set up in the quantitative detection by SYBR Green I or TaqMan system relative to the reference genes ACTB and/or GAPDH. The analytical sensitivity of the tests was amounted to 1024 times dilution (final concentration was 0.07 mg/L). The measured concentration of proviral DNA of BLV in samples after the separation was represented 196-1544 and 38-1344 of RNA ng/µL respectively [Livak et al.
2001].
Later the samples were normalized to a concentration of 50 μg/mL. The specificity of the primers was verified by melting a curve desired product and by results the electrophoresis in 2 % agarose gel stained with ethidium bromide (data not shown).
Algorithm of diagnostics of bovine leukemia virus (BLV)
The efficiency of the designed primers and fluorescent probes was tested on samples of whole blood of cows of black-pied cattle breed from the farms of the Moscow Region and on RID positive for isolated DNA and RNA. For all samples
the concentration of DNA and RNA was determined and samples below 15 μg/mL were excluded from further analysis. Titration was performed to determine the optimum concentration of primers and specific probes
the range of variation was 0.1-0.8 μM (100-800 nM). It was found that the optimal target primer concentrations are 400 nM
the reference genome is 200 nM and the fluorescent probes are 300 nM.
Correlation analysis is based on the values of the threshold cycle (Ct) is the concentration of the DNA was carried out. The analysis showed a 100 % reliable result (no negative for the reference sample gene)
which is observed at concentrations above 100 μg/mL. There was a decrease in the value of Ct with an increase in the concentration of DNA in the isolated sample. For 39 samples
comparative DNA and cDNA testing was performed. It was shown that cDNA provides 100 % confidence in the result (no false negative tests)
while DNA is only 84 %. Also
when testing cDNA
lower Ct values were observed for both the reference and target genes.
The efficacy of detecting proviral BLV DNA when compared with "nested" PCR was 26 %
while for RT-PCR
88 %. In general
proviral RNA was detected in a larger number of cases (more than 99 %). Thus
the effectiveness of the test was 62 % more effective than compared with the classical PCR methods. Determination of the analytical sensitivity of the test on native blood samples with a minimum concentration of target RNA and DNA was performed. When the initial sample was diluted to a given concentration
the PCR was effective up to 8.2*10 3 (analytical sensitivity 8.8*10 3 μg/mL) from the initial concentration.
Alignment of nucleotide sequences was carried out in the program Ugene1.11.3 using algorithms in ClustalX and Muscle [1-2]. Design of primers and fluorescent probes were created by the Primer3 algorithm for “SYBRGreen” “probe” (see Note 7). Further
when primers with the help of factor sorting (Excel) exclude the options that were in the area of increased kinetics of mutations. Including were removed options that did not gain sufficient points in BLAST-score Ufold and the system of internal check at Primer3.
The formation of dimers and secondary structures was tested by UnaFold. The specificity of all oligonucleotides tested the scoring system of the matches in the BLAST system. For the synthesis and PCR selected the best 15-35 variants. To isolate the proviral DNA of BLV
the DNA extraction kit and DNA/RNA isolation was used.
Before isolating
blood leukocyte cells were preincubated with 1:10 0.5 M Na2EDTA in a volume ratio
mixing 1:6 with buffer 1 and incubated for 1 hour at 0°C. The resulting hemolyze mix was centrifuged at 1500 g for 15 minutes. The pellet was resuspended in buffer 2 added in a ratio of 0.8/1 of the original volume of whole blood. The “MMLV RT Kit” was used for the reverse transcription reaction. To carry out the real-time PCR (RT-PCR)
“qPCRmix-HS” was used. The calculated lengths of amplicons ACTB
gapdh
gag
env  were 193
212
199
137 bp respectively.
PCR was carried out on the DNA thermocycler and the fluorescence data were analyzed using the software.
The results of amplification were also visualized using electrophoresis in 3 % agarose gel followed by staining DNA with ethidium bromide of 0.02 %
fixing the image using system image rendering.
When assembling the multiplex reaction
the necessary protocol correction and repeated optimization of the primer and probe concentrations was carried out. Ultimately
the effective primer concentration of the reference gene turned out to be 100 nM
for the target genes was 300 nM
for the fluorescent probes was 300 nM.
The concentration DNA and RNA of BLV was determined on spectrophotometer using a quartz cuvette of 150 μL volume. After isolation the DNA concentration was normalized to the level of 50 µg/ml
and RNA in the reverse transcription reaction was added to 500 ng. The PCR of BLV was run in real time using an optimized algorithm (950C 5 min
{950C 15 sec
53.60C 1 min
720C 45 sec} x 5 steps
{950C 15 sec
53.60C 1 min
720C 45 sec} x40 steps with fluorescence detection) in the reaction volume of 30 μL.
It was confirmed that the primers to BLV allow to obtain the calculated length of amplicons (electrophoresis data are not shown).
Notes
1.Resolving 109.54 g sucrose (Pancreac
USA)
5 mL 1 M Tris-HCl (pH 7.6) (Amresco)
5 mL 1 M MgCl2 (Amresco)
milliQ water (Millipore
USA) to 1000 mL.
2.Resolving 50 mL 0.5 M Na2EDTA (pH 8.0) (Amresco)
15 mL 5 M NaCl (Helicon
Russia)
milliQ water to 1000 mL.
3.The script for RNA blast search is included.
4.Scoring matrix blosum
open/end gap penalty = 10
extending/separation gap penalty = 0.05.
5.The script is integrated in Ugene.
6.The data not shown
and available at [1-2].
1.This is for TaqMan preinstall configuration
we have differed in divalent cations imposed in concentration of 3.0.
2.
where freq(N) is the number of matches without replacements
tax - the total number of sequences in the taxon
Ufold - a coincidence Ufold (0/1 points).
Conclusion
There are presented the two methods of detecting disseminated RNA-containing viruses of cattle and bees
which are of economic importance
are presented. The methods are based on modern PCR in real time. With the help of the described computer programs it is possible to quickly and efficiently select the primer variants
evaluate their selectivity and selectivity
and test the conditions for their application in molecular diagnostics of DNA and RNA viruses. The analytical sensitivity of the tests was from 0.07 mg/L.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз