Анализ состояния генофонда современной популяции темной лесной пчелы Урала и Поволжья

Авторы:
Ильясов Р.А. , Поскряков А.В. , Петухов А.В. , Николенко А.Г.
Название:
Анализ состояния генофонда современной популяции темной лесной пчелы Урала и Поволжья
Страницы:
167-191
скачано
21 раз(а)


We have carried out the molecular genetic research of the dark European bee A. m. mellifera local population belonging to M lineage in 49 districts of Ural and Volga region in comparison with southern subspecies of A. m. caucasica and A. m. carpatica local populations belonging to C lineage in 3 districts of Northern Caucasus and Carpathians region. The genetic research were carried out using 9 microsatellite loci Ap243, 4a110, A24, A8, A43, A113, A88, Ap049 and A28 of nuclear DNA and COI-COII loci of mtDNA. We have discovered low level less to 5% introgression populations of the dark European bee A. m. mellifera in 16 districts of Ural and Volga region. Introgression to 20% was discovered in populations of the dark European bee A. m. mellifera in 8 districts of Ural and Volga region. Five remaining reserves of the dark European bees A. m. mellifera were have been identified in the Ural and Volga region: burzyanskaya (mountain-forest zone of the Republic of Bashkortostan), tatyshlinskaya (Northern Republic of Bashkortostan), yuzhno-prikamskaya (Southern and Central Permskii krai), visherskaya (Northern Permskii krai), kambarskaya (Southern and Central Republic of Udmurtiya). These five populations have formed the basis of the gene pool of the dark European bee A. m. mellifera in the Ural and Volga region. The bulk of the surviving indigenous gene pool of the dark European bee A. m. mellifera (the core of the gene pool of the population A. m. mellifera ) predominantly located in the Permskii krai and the Republic of Bashkortostan. We have calculated the average heterozygosity (Hо = 0,340 ± 0,037, Hs = 0,357 ± 0,032, Ht = 0,421 ± 0,037), coefficients of inbreeding (Fis = 0,081 ± 0,037, Fit = 0,196 ± 0,042, Fst = 0,125 ± 0,023) and coefficient of relatedness (R = 0,210 ± 0,034) for the population of the dark European bee A. m. mellifera of the Ural and Volga region. These genetic standards of the dark European bee A. m. mellifera of the Ural and Volga region will be useful for following population researches in Russia and Europe.
ВВЕДЕНИЕ Из всех 30 европейских подвидов медоносной пчелы Apis mellifera [Ruttner, 1988; Hepburn and Radloff, 1998; Engel, 1999; Sheppard and Meixner, 2003; Meixner et al., 2011; Papachristoforou et al., 2013] только один подвид A. m. mellifera приспособлен к жизни в условиях с экстремально холодными и длительными зимовками, продолжительностью до 6-7 месяцев и критически короткими периодами летнего медосбора [Ruttner, 1988; Hepburn, Radloff, 1998; Engel, 1999; Sheppard, Meixner, 2003; De la Rúa et al., 2009; Meixner et al., 2011; Николенко, Поскряков, 2002]. Аборигенный генофонд темной лесной пчелы A. m. mellifera является источником локальных адаптаций и уникальной комбинации ценных свойств, сформировавшейся в ходе длительного естественного отбора [Büchler et al., 2014]. Темная лесная пчела A. m. mellifera, представитель эволюционной ветви М [Jensen et al., 2005; Whitfield et al., 2006; Soland-Reckeweg et al., 2009; Oleksa et al., 2011; Pinto et al., 2012; Wallberg et al., 2014], на сегодняшний день признана подвидом, находящимся под угрозой вымирания в результате массовой интрогрессии генофонда подвидов пчел эволюционной ветви С [Jensen et al., 2005; Muñoz et al., 2009; Soland-Reckeweg et al., 2009; Oleksa et al., 2011; Pinto et al., 2012; Nedić et al., 2014; Uzunov et al., 2014]. Перемещение пчел разных подвидов между разными регионами ведет к потере чистоты аборигенного генофонда в результате процесса гибридизации [De la Rúa et al., 2009; Dietemann et al., 2009; Meixner et al., 2010]. Потеря уникальности аборигенного генофонда происходит под влиянием таких факторов, как замена местных темных лесных пчел более спокойными и продуктивными подвидами пчел южного происхождения; широкое распространение вредителей и патогенов, таких как паразитический клещ Varroa destructor и микроспоридия Nosema ceranae, которые были причиной сокращения численности пчелиных семей во всем мире; полная осознанная замена популяции темной лесной пчелы пчелами других подвидов [De la Rúa et al., 2009; van Engelsdorp, Meixner, 2010; Potts et al., 2010]. Темная лесная пчела постоянно сталкивается с негативными факторами окружающей среды, такими как интрогессивная гибридизация, фрагментация ареала, загрязнение среды обитания агрохимикатами, распространение в популяции новых патогенов, которые приводят к постепенному снижению естественного генетического разнообразия, сокращению эффективной численности популяции и нарушению коэволюционных генных комплексов, обеспечивающих адаптированность к условиям окружающей среды [Fries et al., 1996; Николенко, Поскряков, 2002; Jensen, Pedersen, 2005; Ильясов и др., 2007а]. Генофонд аборигенных темных лесных пчел A. m. mellifera считают утраченными во многих странах Европы [Jensen, Pedersen, 2005]. Известна полная замена аборигенной темной лесной пчелы A. m. mellifera краинской пчелой A. m. carnica в Германии [Kauhausen-Keller, Keller, 1994; Maul, Hähnle, 1994; Jensen, Pedersen, 2005]. Предпочтение пчеловодов Западной и Северной Европы в разведении пчел эволюционной ветви С [A. m. carnica, A. m. ligustica и гибридная пчела Бэкфаст] по причине их дешивизны, доступности и раннего созревания маток, по сравнению с темной лесной пчелой, способствовало потере целостности ареала A. m. mellifera и интрогрессии генофонда южных подвидов [Peer, 1957; Crane, 1999; Jensen et al., 2005]. В Скандинавских странах и на Британских островах большинство пчеловодов предпочитает разводить A. m. ligustica, A. m. cecropia и A. m. carnica или искусственно выведенную породу бэкфаст [Jensen, Pedersen, 2005]. В России подвид A. m. mellifera был практически повсеместно заменен подвидами A. m. caucasica и A. m. carpatica [Никоноров и др., 1998; Николенко, Поскряков, 2002; Бородачев, Савушкина, 2007; Ильясов и др., 2007а; Ильясов и др., 2015а]. Таким образом, в последние несколько десятков лет естественный ареал A. m. mellifera значительно сократился во всех странах Евразии [Ильясов и др., 2015г]. Сегодня в России имеются значительные массивы чистопородных популяций темной лесной пчелы A. m. mellifera [Ильясов, Поскряков, 2006]. Морфологические исследования пчел предполагали сохранение генофонда темной лесной пчелы A. m. mellifera в России на Урале на территории Пермского края и Республики Башкортостан [Петухов и др., 1996; Никоноров и др., 1998; Николенко, Поскряков, 2002; Гранкин и др., 2004; Ильясов и др., 2007а; Ильясов и др., 2015а; Ильясов и др., 2015б], а также в Поволжье в Республиках Татарстан и Удмуртия и Кировской области [Гранкин и др., 2004; Ильясов и др., 2007б; Колбина и др., 2011; Брандорф и др., 2012; Ильясов и др., 2012]. Наиболее известная популяция - бурзянская бортевая пчела - сохраняется в условиях бортевого пчеловодства, дикого обитания и пасек с рамочными ульями в горно-лесной зоне Южного Урала на территории государственного природного биосферного заповедника «Шульган-Таш», регионального природного заказника «Алтын Солок» и национального парка «Башкирия». Дикие и бортевые пчелы представляют большой интерес для пчеловодов и ученых всего мира, так как по ним можно сделать реконструкцию естественной истории пчел [Ильясов и др., 2015в; Ильясов и др., 2015г]. Для сохранения восстановления аборигенного генофонда медоносной пчелы A. m. mellifera необходимо располагать методами идентификация подвидов и достаточным количеством генетически чистого материала. Еще не так давно в России для идентификации подвидов пчел использовались только морфометрические методы исследования [Никоноров и др., 1998; Николенко, Поскряков, 2002]. Несмотря на то, что морфометрические признаки являются важными при классификации пчел, их трудно использовать для идентификации подвидов, поскольку они сильно подвержены влиянию условий среды обитания и естественного отбора [Никоноров и др., 1998; Franck et al., 2000a; Николенко, Поскряков, 2002]. Генетический маркер, такой как межгенный локус COI-COII мтДНК, уникальный для рода Apis, является самым информативным в исследованиях пчел [Cornuet, Garnery, 1991]. Вариабельность длины нуклеотидной последовательности этого локуса используется для дифференцировки подвидов четырех эволюционных ветвей и идентификации темной лесной пчелы A. m. mellifera [Garnery et al., 1992; Franck et al., 2000b; Sheppard, Smith, 2000]. Генетические исследования на основе локуса COI-COII мтДНК показали, что популяции пчел Урала и Поволжья в России действительно имеют происхождение по материнской линии из семей темной лесной пчелы A. m. mellifera. Однако, более глубоких генетических исследований на основе анализа ядерного генома не проводилось. Данный факт не позволяет доказать, но дает возможность предполагать о 100% принадлежности пчелиных семей к подвиду A. m. mellifera с высокой степенью вероятности, поскольку задействованы как морфологические характеристики, так и маркеры митохондриальной ДНК. Микросателлитные локусы являются современными уникальными информативными ядерными маркерами, позволяющими выявлять популяционно-генетическую структуру, генетическое разнообразие и уровень интрогрессии подвидов пчел в популяции [Cornuet, Garnery, 1991; Clarke et al., 2001; Clarke et al., 2002]. Поддержание генетического разнообразия является важнейшей основой сохранения генофонда темной лесной пчелы [Meixner et al., 2010; Pinto et al., 2014]. Таксономическое разнообразие пчел в Европе является существенным компонентом общего генетического разнообразия вида Apis mellifera. Генетическое и таксономическое разнообразие медоносной пчелы на уровне вида служит материалом для естественного и искусственного отбора и является наиболее важным показателем для успешного развития пчеловодства и сохранения стабильной продуктивности [Ильясов и др., 2015д]. Снижение уровня генетического разнообразия популяций пчел может привести к потере адаптированности к условиям среды обитания и повышению смертности пчел во всем мире [vanEngelsdorp and Meixner, 2010; De la Rúa et al., 2013]. В России ежегодно происходит снижение продуктивности пчелиных семей и массовая гибель после зимовки, что является результатом снижения адаптированности к условиям среды обитания вследствие снижения генетического разнообразия и интрогрессии генофонда южных подвидов [Никоноров и др., 1998; Николенко, Поскряков, 2002; Бородачев, Савушкина, 2007; Ильясов и др., 2007а; Ильясов и др., 2015в; Ильясов и др., 2015д]. Несмотря на то, что медоносная пчела в мире является достаточно активно изучаемым организмом, в России медоносная пчела практически не изучена. В России имеется некоторое количество работ по изучению пчел на основе морфологических параметров, но крайне мало работ на основе генетических параметров. Большинство генетических исследований медоносной пчелы основаны на изучении полиморфизма межгенного локуса COI-COII мтДНК. Исследований на основе изучения локусов ядерной ДНК медоносной пчелы в России практически отсутствуют. Отсутствие полноценной адекватной информации о состоянии и структуре медоносной пчелы в России не позволяет эффективно выполнять мероприятия по сохранению и восстановлению аборигенного генофонда темной лесной пчелы в локальных популяциях, подверженных угрозе интенсивной внутривидовой гибридизации и интрогрессии южных генов. Целью наших исследований является изучение локальных популяций пчел Урала и Поволжья, оценка их основных генетических характеристик, анализ уровня интрогрессии и локализация географических границ сохранившихся резерватов темной лесной пчелы на основе анализа полиморфизма 9 микросателлитных локусов ядерной ДНК и локуса COI-COII мтДНК. МАТЕРИАЛЫ И МЕТОДЫ В исследовании были использованы образцы рабочих пчел из 3123 семей с 493 пасек 49 районов Южного и Среднего Урала и Поволжья, и 3 районов Северного Кавказа и Восточных Карпат, использованных для сравнения в качестве маркера генофонда популяций южных пчел (A. m. caucasica, A. m. carpatica, A. m. carnica). В Республике Башкортостан были отобраны пчелы из 2309 семей с 398 пасек, в Пермском крае - из 362 семей с 41 пасеки, в Республике Удмуртия - из 200 семей с 17 пасек, в Республике Татарстан - из 52 семей с 8 пасек, в Кировской области - из 64 семей с 8 пасек, в Свердловской области - из 58 семей с 8 пасек, в Республике Чувашия - из 14 семей с 2 пасек, в Краснодарском крае - из 32 семей с 3 пасек, в Республике Адыгея - из 15 семей с 2 пасек, в Закарпатской области Украины - из 17 семей с 6 пасек (табл. 1). Рабочих особей пчел фиксировали в 96% этаноле и хранили при температуре -20оС до выделения ДНК. Выделение ДНК из мышц торакса рабочих особей пчел проводили набором ДНК-ЭКСТРАН-2 по протоколу СИНТОЛ (Москва) (www.syntol.ru). Качество и количество выделенной ДНК анализировали на спектрофотометре NanoDrop 1000 (Thermo, США). Таблица 1 Объем выборки семей медоносных пчел по районам Регион Район Семей Пасек Республика Башкортостан Абзелиловский 90 11 Альшеевский 35 6 Баймакский 70 13 Балтачевский 36 7 Белебеевский 16 2 Белорецкий 114 29 Бирский 91 18 Бурзянский 326 90 Гафурийский 62 9 Зилаирский 141 33 Иглинский 197 12 Ишимбайский 226 42 Караидельский 132 19 Кушнаренковский 37 8 Куюргазинский 61 7 Мелеузовский 73 14 Мишкинский 55 12 Татышлинский 200 17 Уфимский 30 4 Учалинский 10 2 Хайбуллинский 130 19 Чекмагушевский 62 12 Чишминский 15 2 Янаульский 100 10 Всего по Республике Башкортостан 2309 398 Пермский край Добрянский 20 2 Красновишерский 41 9 Нытвенский 18 2 Ординский 25 3 Осинский 38 2 Пермский 76 4 Уинский 59 7 Усольский 20 2 Частинский 28 2 Юсьвенский 37 8 Всего по Пермскому краю 362 41 Республика Удмуртия Завьяловский 39 3 Камбарский 46 2 Мало-Пургинский 26 5 Можгинский 22 2 Шарканский 34 2 Якшур-Бодьинский 33 3 Всего по Республике Удмуртия 200 17 Республика Татарстан Кукморский 24 4 Мамадышский 16 2 Нижнекамский 12 2 Всего по Республике Татарстан 52 8 Кировская область Кирово-Чепецкий 20 2 Даровской 20 2 Орловский 14 2 Кильмезский 10 2 Всего по Кировской области 64 8 Свердловская область Красноуфимский 58 8 Республика Чувашия Чебоксарский 14 2 Краснодарский край Сочинский 32 3 Республика Адыгея Майкопский 15 2 Закарпатская область Мукачевский 17 6 Всего 3123 493 Структура популяции и величина интрогрессии генома пчел южного происхождения в локальных популяциях пчел Урала и Поволжья изучались на основе анализа полиморфизма локуса COI-COII мтДНК и микросателлитных локусов ap243, 4a110, a24, a8, a43, a113, a88, ap049 и a28 ядерной ДНК (табл. 2). Таблица 2 Олигонуклеотидные праймеры, использованные для амплификации межгенного локуса COI-COII мтДНК и 9 микросателлитных локусов яДНК медоносной пчелы № Локус Хромосома Последовательность 5’→3’ Номер в Генбанке Автор 1 Ap243 LG1 F AATGTCCGCGAGCATCTG AJ509466 Solignac et al., 2003 R TGTTTACGAGAATTCGACGGG 2 4a110 LG4 F CGCTCGCGGTGGATTTCATTT AF140079 Haberl, Tautz, 1999 R GGCAAAAGTGGCGGAGAAAGA 3 A24 LG7 F CACAAGTTCCAACAATGC AJ509241 Solignac et al., 2003 R CACATTGAGGATGAGCG 4 A8 LG2 F CGAAGGTAAGGTAAATGGAAC AJ509237 Solignac et al., 2003 R GGCGGTTAAAGTTCTGG 5 A43 LG3 F CACCGAAACAAGATGCAAG AJ509256 Solignac et al., 2003 R CCGCTCATTAAGATATCCG 6 A113 LG6 F CTCGAATCGTGGCGTCC AJ509290 Solignac et al., 2003 R CCTGTATTTTGCAACCTCGC 7 A88 LG8 F CGAATTAACCGATTTGTCG AJ509283 Solignac et al., 2003 R GATCGCAATTATTGAAGGAG 8 Ap049 LG1 F CCAATAGCGGCGAGTGTG AJ509334 Solignac et al., 2003 R GGGCTTCGTACGTCCACC 9 A28 LG14 F GAAGAGCGTTGGTTGCAGG AJ509244 Estoup et al., 1995 R GCCGTTCATGGTTACCACG 10 COI-COII Митохондрия F GGCAGAATAAGTGCATTG L06178 Garnery et al., 1993 R CAATATCATTGATGACC Амплификация была выполнена в термоциклере BIO-RAD T100 (США) в 15 мкл общего объема смеси по протоколу СИЛЕКС (Москва) (www.sileks.com/ru) при температуре отжига 550С для 9 микросателлитных локусов (ap243, 4a110, a24, a8, a43, a113, a88, ap049 и a28) [Estoup et al., 1995; Haberl, Tautz, 1999; Solignac et al., 2003] и 480С - для локуса COI-COII мтДНК [Garnery et al., 1993]. Фрагментарный анализ продуктов ПЦР был выполнен на автоматическом секвенаторе Applied Biosystem (США). В проанализированных популяциях пчел по микросателлитным локусам были зафиксированы следующие аллели: по локусу ap243 - 3 аллеля: 254 п.н., 257 п.н. и 260 п.н.; по локусу 4a110 - 3 аллеля: 160 п.н., 163 п.н. и 168 п.н.; по локусу a24 - 3 аллеля: 98 п.н., 106 п.н. и 108 п.н.; по локусу a8 - 5 аллелей: 154 п.н., 156 п.н., 158 п.н., 164 п.н. и 173 п.н.; по локусу a43 - 4 аллеля: 128 п.н., 134 п.н., 140 п.н., и 142 п.н.; по локусу a113 - 6 аллелей: 216 п.н., 218 п.н., 220 п.н., 222 п.н., 228 п.н. и 234 п.н.; по локусу a88 - 5 аллелей: 143 п.н., 146 п.н., 148 п.н., 152 п.н. и 155 п.н.; по локусу ap049 - 4 аллеля: 123 п.н., 129 п.н., 130 п.н. и 142 п.н.; по локусу a28 - 3 аллеля: 134 п.н., 140 п.н. и 144 п.н. Для межгенного локуса COI-COII мтДНК в проанализированных семьях пчел детектировались фрагменты следующих размеров: фрагменты PQQQ - 1023 п.н. и PQQ - 825 п.н., характеризующие пчел, происходящих от A. m. mellifera по материнской линии (эволюционная ветвь М) и фрагенты Q - 644 п.н., характеризующие пчел, происходящих от A. m. caucasica, A. m. carnica, A. m. carpatica, A. m. ligustica по материнской линии (эволюционная ветвь С) [Garnery et al., 1993]. Продукты амплификации разделялись в 8% ПААГ при силе тока 40мА, окрашивались бромистым этидием и фотографировались в гель-документирующей системе DocPrint Vilber Lourmat (Франция). Статистический анализ полученных результатов проводился с использованием программ FSTAT 2.9.3.2, GENEPOP 4.2.2, POPULATIONS 1.2.28, STRUCTURE 2.3.4, STATISTICA 8.0, MICROSOFT EXCEL 2010. РЕЗУЛЬТАТЫ Нами был проанализирован полиморфизм межгенного локуса COI-COII мтДНК, где вариант Q является показателем происхождения семей от южных подвидов A. m. caucasica, A. m. carnica, A. m. carpatica и A. m. ligustica, а вариант PQQ и PQQQ - от темной лесной пчелы подвида A. m. mellifera по материанской линии [Никоноров и др., 1998]. Другие варианты межгенного локуса COI-COII мтДНК, такие как PQ, PQQQQ и PQQQQQ, которые описаны для европейских популяций темной лесной пчелы A. m. mellifera [Franck et al., 1998; Jensen et al., 2005], в изученных нами популяциях пчел Урала и Поволжья не были обнаружены. Анализ полиморфизма локуса COI-COII мтДНК и микросателлитных локусов необходимо проводить раздельно, поскольку митохондриальная ДНК находится в гаплоидном состоянии, а ядерная ДНК - в диплоидном. Оценку состояния и структуры популяции, микроэволюционных процессов, происходящих в ней под влиянием факторов окружающей среды, прогнозирование генетических изменений во времени и сравнение популяций между собой возможно провести только на основе анализа полиморфизма вариабельных ядерных локусов, таких как микросателлитные локусы. Основная и очень важная характеристика популяций - уровень гетерозиготности и генетического разнообразия. Только по значениям гетерозиготности можно определить состояние популяции, которое может находиться в состоянии равновесия, аутбридинга и инбридинга. Отклонение этих показателей от нормы могут привести к негативным последствиям и стать результатом гибели или сокращения эффективной численности популяции. Генетическое разнообразие в популяции пчел является материалом для естественного отбора и генетического дрейфа и служит основой для протекания микроэволюционных процессов. Для успешного сохранения популяции темной лесной пчелы необходимо разведение пчелиных семей с минимальным уровнем интрогрессии генов южных подвидов и оптимальным уровнем генетического разнообразия. Генетическое разнообразие популяций пчел характеризует их экологическую пластичность, которая обеспечивает приспособленность популяции к изменяющимся условиям окружающей среды. Для популяции пчел характерен собственный оптимальный уровень генетического разнообразия. Дефицит генетического разнообразия приводит к потере экологической пластичности и адаптированности к окружающей среде, а избыток - к потере сбалансированности генома и накоплению генетического груза. Известно, что популяции пчел четырех эволюционных ветвей А, М, С и О характеризуются разными оптимальными уровнями гетерозиготности Ho и генетического разнообразия He. Так, по данным анализа полиморфизма большого количества микросателлитных локусов (более 10) в ближневосточных популяциях пчел (эволюционная ветвь О) наблюдаемая оптимальная гетерозиготность Ho = 0,600 - 0,650 [Franck et al. 2000a, 2001], а ожидаемая оптимальная гетерозиготность (генетическое разнообразие) Hs = 0,524 - 0,693 [Bodur, 2005]; в африканских популяциях пчел (эволюционная ветвь А) Ho = 0,760 - 0,900 [Franck et al. 2001], а Hs = 0,770 - 0,880 [Franck et al., 1998]; в средиземноморских популяциях пчел (эволюционная ветвь С) Ho = 0,390 - 0,680 [Franck et al. 2000b], а Hs = 0,756 - 0,896 [Franck et al., 2001]; в западноевропейских популяциях пчел (эволюционная ветвь М) Ho = 0,260 - 0,680 [Garnery et al. 1998, Franck et al 2001], а Hs = 0,290 - 0,380 [Franck et al., 1998]. Как видим, самые высокие значения оптимальной гетерозиготности и генетического разнообразия характерны для африканских популяций пчел эволюционной ветви А. Средние значения оптимальной гетерозиготности и генетическое разнообразие характерны для ближневосточных популяций пчел эволюционной ветви О. Наименьшие значения оптимальной гетерозиготности и генетического разнообразия наблюдаются в западноевропейских популяциях пчел эволюционной ветви М и восточноевропейских и средиземноморских популяциях пчел эволюционной ветви С. Однако, нижняя граница оптимальной гетерозиготности и генетического разнообразия для популяций эволюционной ветви М ниже, чем для популяций эволюционной ветви С. Таким образом, пчелы эволюционной ветви М характеризуются наименьшими значениями оптимальной гетерозиготности и генетического разнообразия. Полученные нами значения гетерозиготности и генетического разнообразия согласуются с литературными данными. На основе результатов анализа полиморфизма 9 микросателлитных локусов ap243, 4a110, A24, A8, A43, A113, A88, Ap049 и A28 ядерной ДНК в популяциях пчел всех 52 районов нами были рассчитаны показатели средней наблюдаемой гетерозиготности на уровне пасек популяции пчел одного района Ho, средней ожидаемой гетерозиготности на уровне пасек популяции пчел одного района (генетического разнообразия) Hs, общей ожидаемой средней гетерозиготности на уровне всей популяции пчел района Ht (табл. 3). Оценка величины средней ожидаемой гетерозиготности на уровне субпопуляций по всем 9 микросателлитным локусам будет характеризовать уровень генетического разнообразия популяции пчел. Поскольку адаптированность пчелиной семьи обеспечивается деятельностью и средней адаптированностью нескольких десятков тысяч рабочих особей, то генетический анализ выборки рабочих особей пчел будет характеризовать средний генетический потенциал всей популяции пчел. Подобная оценка генетических характеристик популяций темной лесной пчелы Урала и Поволжья ранее в таких масштабах не проводилась. Минимальная наблюдаемая гетерозиготность на пасеках Ho = 0,236 (от 0,179 до 0,292) была характерна для локальных популяций пчел 17 районов Урала и Поволжья: Балтачевской, Бурзянской, Камбарской, Красновишерской, Куюргазинской, Малопургинской, Мишкинской, Можгинской, Нижнекамской, Нытвенской, Усольской, Хайбуллинской, Частинской, Юсьвенской, Якшур-Бодьинской, Янаульской. Минимальная ожидаемая по соотношению Харди-Вайнберга гетерозиготность на пасеках Hs = 0,220 (от 0,145 до 0,294) была характерна для локальных популяций пчел 15 районов Урала и Поволжья: Бурзянской, Добрянской, Камбарской, Кукморской, Малопургинской, Можгинской, Нижнекамской, Нытвенской, Осинской, Усольской, Хайбуллинской, Частинской, Юсьвенской, Янаульской, Красновишерской. Минимальная ожидаемая гетерозиготность всей популяции Ht = 0,266 (от 0,236 до 0,296) была характерна для локальных популяций пчел 12 районов Урала и Поволжья: Добрянской, Камбарской, Красновишерской, Малопургинской, Можгинской, Нытвенской, Осинской, Усольской, Частинской, Чебоксарской, Юсьвенской, Янаульской. Максимальные значения наблюдаемой средней гетерозиготности на пасеках Ho = 0,464 (от 0,300 до 0,628) были характерны для локальных популяций пчел 32 районов Урала и Поволжья: Уфимской, Добрянской, Белорецкой, Татышлинской, Чишминской, Уинской, Абзелиловской, Баймакской, Осинской, Кукморской, Завьяловской, Мелеузовской, Ординской, Шарканской, Караидельской, Чебоксарской, Зилаирской, Белебеевской, Гафурийской, Бирской, Красноуфимской, Мамадышской, Кирово-Чепецкой, Альшеевской, Ишимбайской, Иглинской, Кильмезской, Кушнаренковской, Орловской, Учалинской, Чекмагушевской, Даровской. Максимальные значения ожидаемой по соотношению Харди-Вайнберга средней гетерозиготности на пасеках Hs = 0,417 (от 0,304 до 0,529) были характерны для локальных популяций пчел 34 районов Урала и Поволжья: Татышлинской, Чебоксарской, Мишкинской, Пермской, Якшур-Бодьинской, Уинской, Баймакской, Куюргазинской, Белорецкой, Завьяловской, Балтачевской, Ординской, Зилаирской, Красноуфимской, Абзелиловской, Мелеузовской, Кильмезской, Караидельской, Мамадышской, Чекмагушевской, Шарканской, Бирской, Уфимской, Орловской, Гафурийской, Иглинской, Кушнаренковской, Учалинской, Чишминской, Ишимбайской, Белебеевской, Кирово-Чепецкой, Альшеевской, Даровской. Максимальные значения общей гетерозиготности всей популяции Ht = 0,411 (от 0,301 до 0,520) были характерны для локальных популяций пчел 37 районов Урала и Поволжья: Якшур-Бодьинской, Уинской, Татышлинской, Куюргазинской, Мишкинской, Балтачевской, Ординской, Кукморской, Пермской, Хайбуллинской, Завьяловской, Белорецкой, Бурзянской, Кильмезской, Баймакской, Мамадышской, Чекмагушевской, Шарканской, Караидельской, Орловской, Мелеузовской, Красноуфимской, Зилаирской, Чишминской, Нижнекамской, Бирской, Учалинской, Абзелиловской, Иглинской, Кушнаренковской, Уфимской, Кирово-Чепецкой, Гафурийской, Ишимбайской, Белебеевской, Альшеевской, Даровской. Таблица 3 Значения гетерозиготности и коэффициентов инбридинга и родства в локальных популяциях пчел 52 районов, рассчитанные на основе анализа полиморфизма 9 микросателлитных локусов Ap243, 4a110, A24, A8, A43, A113, A88, Ap049 и A28 ядерной ДНК № Локальная популяция N Ho ± σ Hs ± σ Ht ± σ 1 Абзелиловская 90 0,324 ± 0,075 0,350 ± 0,058 0,416 ± 0,071 2 Альшеевская 35 0,421 ± 0,076 0,446 ± 0,062 0,484 ± 0,061 3 Баймакская 70 0,327 ± 0,105 0,317 ± 0,106 0,350 ± 0,117 4 Балтачевская 36 0,292 ± 0,096 0,326 ± 0,090 0,327 ± 0,083 5 Белебеевская 16 0,369 ± 0,072 0,432 ± 0,064 0,482 ± 0,046 6 Бирская 91 0,372 ± 0,096 0,381 ± 0,074 0,408 ± 0,074 7 Бурзянская 326 0,276 ± 0,039 0,250 ± 0,036 0,344 ± 0,059 8 Белорецкая 114 0,302 ± 0,060 0,323 ± 0,038 0,342 ± 0,048 9 Гафурийская 62 0,371 ± 0,070 0,394 ± 0,044 0,448 ± 0,051 10 Зилаирская 141 0,367 ± 0,086 0,333 ± 0,066 0,390 ± 0,088 11 Иглинская 197 0,426 ± 0,086 0,399 ± 0,046 0,418 ± 0,053 12 Ишимбайская 226 0,422 ± 0,039 0,429 ± 0,026 0,476 ± 0,037 13 Караидельская 132 0,347 ± 0,080 0,367 ± 0,070 0,383 ± 0,075 14 Кушнаренковская 37 0,500 ± 0,116 0,406 ± 0,061 0,429 ± 0,063 15 Куюргазинская 61 0,292 ± 0,096 0,320 ± 0,091 0,322 ± 0,093 16 Мелеузовская 73 0,338 ± 0,067 0,354 ± 0,057 0,386 ± 0,052 17 Мишкинская 55 0,278 ± 0,102 0,307 ± 0,095 0,322 ± 0,103 18 Татышлинская 200 0,305 ± 0,104 0,304 ± 0,096 0,321 ± 0,102 19 Янаульская 100 0,209 ± 0,075 0,249 ± 0,100 0,263 ± 0,109 20 Уфимская 30 0,300 ± 0,065 0,381 ± 0,058 0,429 ± 0,064 21 Учалинская 10 0,533 ± 0,165 0,406 ± 0,088 0,412 ± 0,088 22 Чишминская 15 0,311 ± 0,085 0,411 ± 0,069 0,402 ± 0,070 23 Чекмагушевская 62 0,584 ± 0,175 0,377 ± 0,095 0,380 ± 0,096 24 Хайбуллинская 130 0,268 ± 0,093 0,292 ± 0,101 0,334 ± 0,127 25 Уинская 59 0,316 ± 0,119 0,315 ± 0,111 0,319 ± 0,112 26 Ординская 25 0,340 ± 0,130 0,328 ± 0,126 0,327 ± 0,131 27 Частинская 28 0,262 ± 0,141 0,248 ± 0,132 0,243 ± 0,130 28 Нытвенская 18 0,272 ± 0,126 0,253 ± 0,113 0,247 ± 0,110 29 Осинская 38 0,327 ± 0,167 0,247 ± 0,114 0,244 ± 0,113 30 Пермская 76 0,292 ± 0,112 0,307 ± 0,094 0,333 ± 0,106 31 Юсьвенская 37 0,241 ± 0,108 0,261 ± 0,110 0,269 ± 0,110 32 Красновишерская 41 0,180 ± 0,104 0,145 ± 0,075 0,241 ± 0,117 33 Усольская 20 0,256 ± 0,142 0,294 ± 0,094 0,286 ± 0,091 34 Добрянская 20 0,300 ± 0,124 0,273 ± 0,098 0,267 ± 0,096 35 Красноуфимская 58 0,383 ± 0,119 0,339 ± 0,082 0,387 ± 0,084 36 Кукморская 24 0,327 ± 0,138 0,280 ± 0,082 0,328 ± 0,108 37 Нижнекамская 12 0,185 ± 0,127 0,285 ± 0,054 0,405 ± 0,073 38 Мамадышская 16 0,389 ± 0,111 0,373 ± 0,111 0,376 ± 0,112 39 Малопургинская 26 0,227 ± 0,091 0,268 ± 0,083 0,290 ± 0,095 40 Шарканская 34 0,344 ± 0,089 0,378 ± 0,079 0,382 ± 0,074 41 Камбарская 46 0,242 ± 0,118 0,291 ± 0,121 0,291 ± 0,121 42 Можгинская 22 0,263 ± 0,106 0,270 ± 0,114 0,266 ± 0,113 43 Завьяловская 39 0,333 ± 0,098 0,323 ± 0,080 0,340 ± 0,088 44 Якшур-Бодьинская 33 0,267 ± 0,100 0,310 ± 0,115 0,313 ± 0,117 45 Чебоксарская 14 0,357 ± 0,138 0,304 ± 0,106 0,296 ± 0,103 46 Кирово-Чепецкая 20 0,389 ± 0,118 0,441 ± 0,043 0,430 ± 0,042 47 Даровская 20 0,628 ± 0,074 0,529 ± 0,053 0,520 ± 0,050 48 Орловская 14 0,500 ± 0,167 0,393 ± 0,113 0,384 ± 0,111 49 Кильмезская 10 0,478 ± 0,181 0,356 ± 0,106 0,349 ± 0,103 50 Майкопская 15 0,188 ± 0,099 0,238 ± 0,122 0,236 ± 0,119 51 Сочинская 32 0,179 ± 0,097 0,170 ± 0,084 0,243 ± 0,097 52 Мукачевская 17 0,256 ± 0,071 0,238 ± 0,077 0,301 ± 0,095 Примечание. Ho - усредненная наблюдаемая гетерозиготность субпопуляций; Hs - усредненная ожидаемая гетерозиготность субпопуляций; Ht - общее генное разнообразие всей популяции в целом, σ - стандартная ошибка. Средние значения гетерозиготности для 49 локальных популяций пчел Урала и Поволжья Hо = 0,340 ± 0,037, Hs = 0,357 ± 0,032, Ht = 0,421 ± 0,037 согласуются с оптимальными значениями гетерозиготности для популяций пчел эволюционной ветви М [Franck et al., 1998; Garnery et al., 1998, Franck et al., 2001] и немного меньше гетерозиготности в популяциях западноевропейских пчел Apis mellifera mellifera из Швейцарии (эволюционная ветвь М) Ho = 0,442, Hs = 0,449, Ht = 0,455, рассчитанные G. Soland-Reckeweg et al. [2009] на основе анализа 9 микросателлитных локусов. Средняя гетерозиготность в популяциях пчел 3 районов Северного Кавказа и Восточных Карпат Hо = 0,192 ± 0,041, Hs = 0,253 ± 0,054, Ht = 0,320 ± 0,072 были ниже гетерозиготностей в популяции пчел Урала и Поволжья, а также ниже оптимальных значений для популяций пчел эволюционной ветви С, рассчитанные P. Franck et al. (2000b) на основе анализа 8 микросателлитных локусов; ниже гетерозиготности в популяциях восточноевропейских пчел эволюционной ветви С в Сербии Ho = 0,426, Hs = 0,421, Ht = 0,456, рассчитанные I. Pihler et al. [2014] на основе анализа 25 микросателлитных локусов. Такие низкие значения гетерозиготности, возможно, объясняются как особенностями балансирующего отбора в пользу гомозигот, процессами инбридинга и особенностями выборки пчелиных семей. Более высокие значения гетерозиготности по сравнению с гетерозиготностью популяции Урала и Поволжья были отмечены для популяции Apis mellifera ligustica эволюционной ветви С в Китае Ho = 0,533, Hs = 0,521, Ht = 0,539, рассчитанные L. Yin et al. [2011] на основе анализа 18 микросателлитных локусов; в популяции ближневосточных пчел эволюционной ветви О в Турции Ho = 0,563, Hs = 0,611, Ht = 0,651, рассчитанные Ç. Bodur [2005] на основе анализа 9 микросателлитных локусов; в популяции африканизированных пчел эволюционной ветви А в Пуэрто-Рико Ho = 0,735, Hs = 0,753, Ht = 0,766, рассчитанные A. Galindo-Cardona et al. [2013] на основе анализа 8 микросателлитных локусов. Таким образом, полученные нами значения гетерозиготности и генетического разнообразия для популяций пчел Урала и Поволжья соответствуют оптимальным значениям для популяций пчел эволюционной ветви М [Franck et al., 1998; Garnery et al., 1998; Franck et al., 2001], очень близки к значениям гетерозиготности в западноевропейских популяциях пчел эволюционной ветви М [Soland-Reckeweg et al., 2009] и значительно ниже гетерозиготности в популяциях пчел эволюционной ветви О на Ближнем Востоке [Franck et al., 2000a; 2001; Bodur, 2005] и эволюционной ветви А в Африке [Franck et al., 1998; 2001; Galindo-Cardona et al., 2013]. Для всех популяций 52 районов были расчитаны индексы фиксации, или коэффициенты инбридинга. S. Wright [1978] предложил концепцию F-статистики: Fis, Fit и Fst, посредством которых можно оценить разные варианты отклонения от равновесия Харди-Вайнберга в объединенной популяции при наличии ее подразделенности на субпопуляции. Для оценки дифференциации между субпопуляциями применима F-статистика: средний показатель инбридинга на пасеках популяции пчел одного района Fis, средний показатель инбридинга популяции пчел одного района Fit, показатель генетической дифференциации популяции пчел одного района Fst (табл. 4). Минимальный дефицит гетерозигот, инбридинг и распределение генотипов, приближенное к равновесному соотношению по Харди-Вайнбергу на пасеках Fis = 0,086 (от 0,003 до 0,169), наблюдалось в локальных популяциях пчел 28 районов Урала и Поволжья: Бурзянской, Татышлинской, Завьяловской, Можгинской, Баймакской, Ишимбайской, Бирской, Пермской, Мелеузовской, Юсьвенской, Абзелиловской, Белорецкий, Шарканской, Караидельской, Куюргазинской, Мишкинской, Хайбуллинской, Гафурийской, Альшеевской, Балтачевской, Кирово-Чепецкой, Якшур-Бодьинской, Усольской, Малопургинской, Белебеевской, Уфимской, Янаульской, Камбарской. Минимальный избыток гетерозигот, аутбридинг и распределение генотипов, приближенное к равновесному соотношению по Харди-Вайнбергу на пасеках Fis = -0,100 (от -0,009 до -0,186), наблюдался в локальных популяциях пчел 14 районов Урала и Поволжья: Даровской, Кушнаренковской, Чебоксарской, Кукморской, Добрянской, Красноуфимской, Зилаирской, Нытвенской, Частинской, Иглинской, Мамадышской, Красновишерской, Уинской, Ординской. Таблица 4 Значения гетерозиготности и коэффициентов инбридинга и родства в локальных популяциях пчел 52 районов, рассчитанные на основе анализа полиморфизма 9 микросателлитных локусов № Локальная популяция N Fis ± σ Fit ± σ Fst ± σ R ± σ 1 Абзелиловская 90 0,074 ± 0,072 0,212 ± 0,077 0,149 ± 0,025 0,246 ± 0,033 2 Альшеевская 35 0,093 ± 0,084 0,164 ± 0,097 0,079 ± 0,031 0,135 ± 0,044 3 Баймакская 70 0,030 ± 0,027 0,116 ± 0,081 0,089 ± 0,018 0,159 ± 0,027 4 Балтачевская 36 0,100 ± 0,090 0,115 ± 0,110 0,017 ± 0,015 0,031 ± 0,030 5 Белебеевская 16 0,150 ± 0,078 0,308 ± 0,096 0,186 ± 0,073 0,285 ± 0,098 6 Бирская 91 0,042 ± 0,033 0,106 ± 0,096 0,067 ± 0,023 0,121 ± 0,034 7 Бурзянская 326 0,003 ± 0,002 0,179 ± 0,056 0,176 ± 0,016 0,299 ± 0,018 8 Белорецкий 114 0,081 ± 0,059 0,139 ± 0,052 0,063 ± 0,023 0,111 ± 0,040 9 Гафурийская 62 0,091 ± 0,077 0,158 ± 0,082 0,074 ± 0,021 0,127 ± 0,030 10 Зилаирская 141 -0,088±0,080 0,061 ± 0,013 0,052 ± 0,042 0,100 ± 0,082 11 Иглинская 197 -0,048±0,044 -0,006±0,069 0,040 ± 0,015 0,081 ± 0,031 12 Ишимбайская 226 0,031 ± 0,021 0,123 ± 0,037 0,094 ± 0,013 0,168 ± 0,024 13 Караидельская 132 0,084 ± 0,056 0,113 ± 0,053 0,032 ± 0,017 0,057 ± 0,030 14 Кушнаренковская 37 -0,174±0,119 -0,105±0,100 0,058 ± 0,035 0,130 ± 0,080 15 Куюргазинская 61 0,089 ± 0,164 0,113 ± 0,100 0,026 ± 0,055 0,046 ± 0,103 16 Мелеузовская 73 0,059 ± 0,054 0,140 ± 0,085 0,086 ± 0,039 0,151 ± 0,062 17 Мишкинская 55 0,089 ± 0,070 0,131 ± 0,061 0,046 ± 0,037 0,082 ± 0,065 18 Татышлинская 200 0,004 ± 0,003 0,049 ± 0,044 0,137 ± 0,022 0,258 ± 0,035 19 Янаульская 100 0,159 ± 0,040 0,210 ± 0,053 0,176 ± 0,032 0,270 ± 0,052 20 Уфимская 30 0,154 ± 0,072 0,303 ± 0,085 0,060 ± 0,049 0,100 ± 0,062 21 Учалинская 10 -0,315±0,179 -0,277±0,201 0,029 ± 0,023 0,081 ± 0,055 22 Чишминская 15 0,204 ± 0,128 0,170 ± 0,122 -0,043±0,021 -0,073±0,033 23 Чекмагушевская 62 -0,560±0,135 -0,549±0,012 0,007 ± 0,138 0,030 ± 0,054 24 Хайбуллинская 130 0,089 ± 0,063 0,208 ± 0,083 0,131 ± 0,037 0,217 ± 0,049 25 Уинская 59 -0,012±0,010 -0,003±0,002 0,010 ± 0,010 0,019 ± 0,010 26 Ординская 25 -0,009±0,007 -0,014±0,011 -0,005±0,004 -0,010±0,006 27 Частинская 28 -0,058±0,064 -0,095±0,064 -0,035±0,002 -0,077±0,001 28 Нытвенская 18 -0,073±0,054 -0,131±0,053 -0,054±0,003 -0,125±0,001 29 Осинская 38 -0,328±0,134 -0,352±0,132 -0,018±0,004 -0,056±0,001 30 Пермская 76 0,043 ± 0,095 0,148 ± 0,117 0,110 ± 0,037 0,192 ± 0,050 31 Юсьвенская 37 0,070 ± 0,052 0,088 ± 0,045 0,020 ± 0,025 0,036 ± 0,045 32 Красновишерская 41 -0,036±0,029 0,124 ± 0,078 0,155 ± 0,072 0,275 ± 0,042 33 Усольская 20 0,130 ± 0,127 0,078 ± 0,059 -0,060±0,009 -0,111±0,001 34 Добрянская 20 -0,100±0,071 -0,151±0,071 -0,047±0,004 -0,111±0,001 35 Красноуфимская 58 -0,091±0,088 0,045 ± 0,050 0,124 ± 0,113 0,238 ± 0,085 36 Кукморская 24 -0,122±0,101 0,125 ± 0,076 0,220 ± 0,147 0,392 ± 0,099 37 Нижнекамская 12 0,351 ± 0,180 0,647 ± 0,098 0,456 ± 0,054 0,554 ± 0,064 38 Мамадышская 16 -0,043±0,038 -0,028±0,023 0,014 ± 0,011 0,030 ± 0,024 39 Малопургинская 26 0,134 ± 0,102 0,227 ± 0,088 0,108 ± 0,039 0,175 ± 0,064 40 Шарканская 34 0,081 ± 0,055 0,101 ± 0,050 0,021 ± 0,014 0,039 ± 0,025 41 Камбарская 46 0,169 ± 0,052 0,172 ± 0,048 0,003 ± 0,002 0,005 ± 0,014 42 Можгинская 22 0,026 ± 0,022 -0,004±0,004 -0,031±0,021 -0,061±0,005 43 Завьяловская 39 0,004 ± 0,003 0,086 ± 0,035 0,082 ± 0,017 0,151 ± 0,033 44 Якшур-Бодьинская 33 0,129 ± 0,032 0,148 ± 0,031 0,022 ± 0,009 0,038 ± 0,014 45 Чебоксарская 14 -0,174±0,029 -0,245±0,023 -0,061±0,002 -0,161±0,004 46 Кирово-Чепецкая 20 0,118 ± 0,090 0,073 ± 0,072 -0,051±0,004 -0,095±0,003 47 Даровская 20 -0,186±0,076 -0,230±0,074 -0,037±0,005 -0,097±0,004 48 Орловская 14 -0,273±0,086 -0,332±0,083 -0,047±0,006 -0,140±0,006 49 Кильмезская 10 -0,344±0,100 -0,396±0,091 -0,039±0,011 -0,129±0,018 50 Майкопская 15 0,249 ± 0,043 0,237 ± 0,040 -0,016±0,015 -0,026±0,024 51 Сочинская 32 0,049 ± 0,043 0,481 ± 0,147 0,455 ± 0,151 0,614 ± 0,167 52 Мукачевская 17 -0,086±0,073 0,158 ± 0,066 0,224 ± 0,034 0,387 ± 0,052 Примечание. Fis- коэффициент инбридинга особи относительно субпопуляции; Fit - коэффициент инбридинга особи относительно всей популяции в целом; Fst- коэффициент инбридинга выборки относительно всей популяции в целом (межпопуляционый компонент изменчивости, подразделенность популяции). Минимальный дефицит гетерозигот, инбридинг и распределение генотипов, приближенное к равновесному соотношению по Харди-Вайнбергу во всей популяции Fit = 0,112 (от 0,045 до 0,179), наблюдалось в локальных популяциях пчел 26 районов Урала и Поволжья: Красноуфимской, Татышлинской, Зилаирской, Кирово-Чепецкой, Усольской, Завьяловской, Юсьвенской, Шарканской, Бирской, Караидельской, Куюргазинской, Балтачевской, Баймакской, Ишимбайской, Красновишерской, Кукморской, Мишкинской, Белорецкий, Мелеузовской, Пермской, Якшур-Бодьинской, Гафурийской, Альшеевской, Чишминской, Камбарской, Бурзянской. Минимальный избыток гетерозигот, аутбридинг и распределение генотипов, приближенное к равновесному соотношению по Харди-Вайнбергу во всей популяции Fit = -0,077 (от -0,003 до -0,151), наблюдалось в локальных популяциях пчел 9 районов Урала и Поволжья: Добрянской, Нытвенской, Кушнаренковской, Частинской, Мамадышской, Ординской, Иглинской, Можгинской, Уинской. Максимальный дефицит гетерозигот, инбридинг и отклонение распределения генотипов от равновесного соотношения по Харди-Вайнбергу на пасеках Fis = 0,278 (от 0,204 до 0,351) наблюдалось в локальных популяциях пчел 2 районов Урала и Поволжья: Чишминской и Нижнекамской. Максимальный избыток гетерозигот, аутбридинг и отклонение распределения генотипов от равновесного соотношения по Харди-Вайнбергу на пасеках Fis = -0,417 (от -0,273 до -0,560), наблюдалось в локальных популяциях пчел 5 районов Урала и Поволжья: Чекмагушевской, Кильмезской, Осинской, Учалинской, Орловской. Максимальный дефицит гетерозигот, инбридинг и отклонение распределения генотипов от равновесного соотношения по Харди-Вайнбергу во всей популяции Fit = 0,428 (от 0,208 до 0,647) наблюдалось в локальных популяциях пчел 7 районов Урала и Поволжья: Хайбуллинской, Янаульской, Абзелиловской, Малопургинской, Уфимской, Белебеевской, Нижнекамской. Максимальный избыток гетерозигот, аутбридинг и отклонение распределения генотипов от равновесного соотношения по Харди-Вайнбергу Fit = -0,390 (от -0,230 до -0,549) наблюдалось в локальных популяциях пчел 7 районов Урала и Поволжья: Чекмагушевской, Кильмезской, Осинской, Орловской, Учалинской, Чебоксарской, Даровской. Средние значения коэффициентов инбридинга в 49 популяциях пчел Урала и Поволжья на уровне пасек и всей популяции Fis = 0,081 ± 0,037, Fit = 0,196 ± 0,042 были ниже по сравнению с популяциями пчел 3 районов Северного Кавказа и Восточных Карпат Fis = 0,268 ± 0,082, Fit = 0,517 ± 0,119. Коэффициенты инбридинга в 49 популяциях пчел Урала и Поволжья на уровне пасек и всей популяции сходны с коэффициентами инбридинга Fis = 0,078 и Fit = 0,081 в популяциях африканизированных пчел эволюционной ветви А в Пуэрто-Рико, рассчитанные A. Galindo-Cardona et al. [2013] по 8 микросателлитным локусам. Коэффициенты инбридинга в 49 популяциях пчел Урала и Поволжья на уровне пасек и всей популяции оказались выше коэффициентов инбридинга Fis = 0,010 и Fit = 0,083 в популяции ближневосточных пчел эволюционной ветви О в Турции, рассчитанные Ç. Bodur [2005] на основе анализа 9 микросателлитных локусов; выше коэффициентов инбридинга Fis = 0,027 и Fit = 0,067 в популяции восточноевропейских пчел эволюционной ветви С в Сербии, рассчитанные I. Pihler et al. [2014] на основе анализа 25 микросателлитных локусов; выше коэффициентов инбридинга Fis = -0,004 и Fit = 0,034 в популяции Apis mellifera ligustica эволюционной ветви С в Китае, рассчитанные L. Yin et al. [2011] на основе анализа 25 микросателлитных локусов; выше коэффициентов инбридинга Fis = 0,016 и Fit = 0,028 в популяции западноевропейских пчел Apis mellifera mellifera эволюционной ветви М в Швейцарии, рассчитанные G. Soland-Reckeweg et al. [2009] на основе анализа 9 микросателлитных локусов. Более высокие значения коэффициентов инбридинга могут быть связаны с особенностями искусственного отбора и технологий содержания и размножения пчелиных семей на пасеках в России, а также могут быть вызваны явлениями резкой экстинкции под влиянием неблагоприятных факторов окружающей среды в условиях резкоконтинентального климата с последующей экспансией пчелиных семей. Высокие уровни избытка гетерозигот на пасеках Fis и во всей популяции Fit характеризуют процессы аутбридинга с преобладанием скрещивания генетически отдаленных особей. Такое явление часто происходит в случае импорта пчелиных семей из популяций отдаленных регионов, а также в случае импорта пчелиных семей других подвидов эволюционной ветви С из южных регионов. Генетическое смешение и долговременное поддержание гаметического неравновесия могут иметь различные последствия - положительные и отрицательные. Положительными последствиями являются увеличение генетической изменчивости и генетического разнообразия. Отрицательные последствия весьма многочисленны: неравновесие, ведущее к снижению общей приспособленности гибридной популяции; интрогрессия вредных и неадаптированных генотипов в аборигенную популяцию, что ведет к их деградации и замещению другим подвидом, как правило, с худшими качествами и для человека и для экосистемы. Важнейший показатель генетической структуры популяции - продразделенность на субпопуляции. Для разных организмов существует собственный оптимальный уровень подразделенности популяции, который зависит от подвижности и активности особей. Для популяции пчел определенного района обитания подразделенность формируется в основном за счет дифференциации на пасеки. В масштабах континента подразделенность популяции пчел формируется за счет экотипов, обитающих в разных климатических условиях. Величина подразделенности характеризует уровень структурированности популяции, которая обеспечивает ей устойчивость к условиям окружающей среды. Кроме того, коэффициент подразделенности популяции отражает генетические процессы, протекающие в популяции, такие как - миграция и ассортативность скрещивания. Минимальные значения подразделенности всей популяции Fst = 0,049 (от 0,003 до 0,094) были характерны для локальных популяций пчел 37 районов Урала и Поволжья: Камбарской, Ординской, Чекмагушевской, Уинской, Мамадышской, Балтачевской, Осинской, Юсьвенской, Шарканской, Якшур-Бодьинской, Куюргазинской, Учалинской, Можгинской, Караидельской, Частинской, Даровской, Кильмезской, Иглинской, Чишминской, Мишкинской, Добрянской, Орловской, Кирово-Чепецкой, Зилаирской, Нытвенской, Кушнаренковской, Уфимской, Усольской, Чебоксарской, Белорецкий, Бирской, Гафурийской, Альшеевской, Завьяловской, Мелеузовской, Баймакской, Ишимбайской. Максимальные значения подразделенности всей популяции Fst = 0,282 (от 0,108 до 0,456) были характерны для локальных популяций пчел 12 районов Урала и Поволжья: Малопургинской, Пермской, Красноуфимской, Хайбуллинской, Татышлинской, Абзелиловской, Красновишерской, Бурзянской, Янаульской, Белебеевской, Кукморской, Нижнекамской. Средний коэффициент подразделенности популяции пчел 49 районов Урала и Поволжья Fst = 0,125 ± 0,023 был ниже коэффициента подразделенности популяции пчел 3 районов Северного Кавказа и Восточных Карпат Fst = 0,340 ± 0,145. Более низкое значение коэффициента подразделенности получено для популяции африканизированных пчел эволюционной ветви А в Пуэрто-Рико Fst = 0,017, рассчитанные A. Galindo-Cardona et al. [2013] на основе анализа 8 микросателлитных локусов; для популяции ближневосточных пчел эволюционной ветви О в Турции Fst = 0,074, рассчитанные Ç. Bodur [2005] на основе анализа 9 микросателлитных локусов; для популяции восточно-европейских пчел эволюционной ветви С в Сербии Fst = 0,043, рассчитанные I. Pihler et al. [2014] на основе анализа 25 микросателлитных локусов; для популяции Apis mellifera ligustica эволюционной ветви С в Китае Fst = 0,037, рассчитанные L. Yin et al. [2011] на основе анализа 18 микросателлитных локусов; для популяции западноевропейских пчел Apis mellifera mellifera эволюционной ветви М в Швейцарии Fst = 0,013, рассчитанные G. Soland-Reckeweg et al. (2009) на основе анализа 9 микросателлитных локусов. Более высокие значения коэффициента подразделенности, возможно, связаны с меньшей миграционной активностью наших пчеловодов, ведущих преимущественно оседлый тип пчеловодства на стационарных пасеках. Коэффициент родства R [Hamilton, 1964; Queller, Goodnight, 1989] характеризует среднюю степень родственных отношений пчелиных семей в популяции пчел одного района. Известно, что родство R = 0,28 наблюдается между рабочими особями от одной матки, R = 0,25 - между трутнями и рабочими особями от одной матки, R = 0,25 - между маткой и ее рабочими особями, R = 0,5 - между трутнями-братьями от одной матки, R = 0,75 - между матками-сестрами от одной матки, R = 0,06 - между рабочими пчелами от разных маток. Популяции пчел с преобладанием пчелиных семей, находящихся в неродственных друг с другом отношениях, будут характеризоваться коэффициентом родства R от 0 до 0,25. Популяции пчел с преобладанием пчелиных семей, находящихся в близкородственных отношениях, как по происхождению, так и в результате перекрестного скрещивания, будут характеризоваться коэффициентом родства R от 0,25 до 1 [Neumann, 1998]. Коэффициент родства характеризует популяцию и оценивает родственные взаимоотношения между составляющими популяцию пчелиными семьями. Для популяции каждого вида существует собственный опитмальный уровень коэффициента родства, превышение или недостаток которого может привести либо к избытку гетерозигот с накоплением генетического груза, либо к дефициту гетерозигот с потерей генетического разнообразия. Нами были рассчитаны коэффициенты родства R для всех популяций пчел 52 районов на основе полиморфизма 9 микросателлитных локусов. Пчелиные семьи, состоящие в неродственных отношениях друг с другом со средним коэффициентом родства R = 0,126 (от 0,005 до 0,246), преобладали в локальных популяциях пчел 42 районов Урала и Поволжья: Камбарской, Ординской, Уинской, Чекмагушевской, Мамадышской, Балтачевской, Юсьвенской, Якшур-Бодьинской, Шарканской, Куюргазинской, Осинской, Караидельской, Можгинской, Чишминской, Частинской, Иглинской, Учалинской, Мишкинской, Кирово-Чепецкой, Даровской, Уфимской, Зилаирской, Белорецкой, Усольской, Добрянской, Бирской, Нытвенской, Гафурийской, Кильмезской, Кушнаренковской, Альшеевской, Орловской, Мелеузовской, Завьяловской, Баймакской, Чебоксарской, Ишимбайской, Малопургинской, Пермской, Хайбуллинской, Красноуфимской, Абзелиловской. Пчелиные семьи, состоящие в близкородственных отношениях друг с другом со средним коэффициентом родства R = 0,436 (от 0,258 до 0,554), преобладали в локальных популяциях пчел 7 районов Урала и Поволжья: Татышлинской, Янаульской, Красновишерской, Белебеевской, Бурзянской, Кукморской, Нижнекамской. Средний коэффициент родства для популяций пчел 49 районов Урала и Поволжья R = 0,210 ± 0,034 был ниже коэффициента родства для популяции пчел 3 районов Северного Кавказа и Восточных Карпат R = 0,459 ± 0,171. Это свидетельствует о том, что в популяциях пчел Северного Кавказа и Восточных Карпат большинство семей находятся в родственных отношениях друг с другом, тогда как в популяции пчел Урала и Поволжья большинство семей находятся в неродственных друг с другом отношениях. В популяции пчел Северного Кавказа и Восточных Карпат можно отдельно выделить популяцию пчел Майкопского района, в которой преобладали пчелиные семьи, находящиеся в неродственных друг с другом отношениях. Возможно, что в эту популяцию были завезены семьи карпатских пчел из других районов Северного Кавказа и Восточных Карпат. Коэффициенты родства для популяций пчел Урала и Поволжья, а также Северного Кавказа и Восточных Карпат были очень сходны и сопоставимы с коэффициентами родства в популяции пчел A. m. mellifera эволюционной ветви М из Montfavet во Франции R = 0,299, с коэффициентами родства в популяции пчел A. m. mellifera эволюционной ветви М из Courcome во Франции R = 0,300, с коэффициентами родства в популяции пчел A. m. carnica эволюционной ветви С из Berlin в Германии R = 0,279, с коэффициентами родства в популяции пчел A. m. ligustica эволюционной ветви С из Bologna в Италии R = 0,278, рассчитанные A. Estoup et al. (1994) на основе анализа 10 микросателлитных локусов. В популяциях пчел Нижнекамского и Сочинского районов коэффициенты родства пчелиных семей превышали значения родства, рассчитанные A. Estoup et al. (1994), что может быть объяснено эффектом бутылочного горлышка, который произошел в результате экстремального сокращения численности в зимний период и последующего восстановления численности из оставшихся семей. Преобладание на пасеках семей пчел, находящихся в близкородственных отношениях друг с другом, свидетельствует о генетической изоляции, ограниченности миграций и потока генов из других популяций, а также о присутствии искусственного отбора пчел, происходящих из ограниченного числа семей, в пользу сохранения аборигенного генофонда. Популяции с такими пасеками могут стать центрами сохранения чистых линий подвида, поскольку характеризуются значительной стабильностью генофонда во времени. Эффекты основателя и бутылочного горлышка могут стать причиной снижения генетического разнообразия и гетерозиготности, повышения инбридинга и коэффициента родства. Преобладание на пасеках семей пчел, находящихся в неродственных отношениях друг с другом, характеризует неорганизованное пчеловодство без селекции, изоляции и контроля миграции пчелиных семей из других регионов. Популяции с такими пасеками находятся под угрозой потери чистотых линий аборигенного генофонда в результате интрогрессии генов из популяций пчел южных регионов. Для успешного сохранения таких популяций необходим постоянный мониторинг состояния генетической структуры с целью предотвращения на ранней стадии возможных необратимых изменений. ОБСУЖДЕНИЕ Генетические дистанции - важнейший инструмент, позволяющий сравнивать популяции друг с другом и определять величину их дивергенции. Для каждого вида существуют свои оптимальные значения генетических дистанций между популяциями, которые напрямую зависят от величины миграции и изоляции. Знание генетических дистанций позволит разумно подойти к сохранению генетического разнообразия и добиться максимальной приспособленности популяции пчел. Попарные значения Fst между популяциями характеризуют генетические дистанции между ними [Galindo-Cardona et al., 2013]. Нами была построена дендрограмма для определения генетических взаимоотношений на основе попарных значений Fst между популяциями пчел 52 районов, полученные по результатам анализа полиморфизма 9 микросателлитных локусов Ap243, 4a110, A24, A8, A43, A113, A88, Ap049 и A28 методом кластеризации ближайшего соседа (Neighbour joining) (NJ) (рис. 1). Рис. 1. Дендрограмма генетических взаимоотношений локальных популяций пчел 52 районов, построенная на основе анализа полиморфизма 9 микросателлитных локусов Ap243, 4a110, A24, A8, A43, A113, A88, Ap049 и A28 ядерной ДНК. На дендрограмме все популяции пчел 52 районов подразделялись на две основные группы, разделяющие популяции пчел Урала и Поволжья от популяций Северного Кавказа и Восточных Карпат. Первая группа объединила популяции пчел подвидов A. m. caucasica и A. m. carpatica (эволюционная ветвь С) 3 районов Северного Кавказа и Восточных Карпат: Краснодарского, Мукачевского, Майкопского. Вторая большая группа объединила популяции пчел подвида A. m. mellifera (эволюционная ветвь М) и их гибридов с подвидами A. m. caucasica и A. m. carpatica на территории Урала и Поволжья. Вторая группа пчел подразделяется на 4 подгруппы, в зависимости от степени гибридизации с пчелами эволюционной ветви С. Первая подгруппа объединила локальные популяции пчел 4 районов Урала и Поволжья: Орловскую, Мамадышскую, Кильмезскую, Нижнекамскую. Эта группа объединяет гибридные популяции пчел, которые генетически близки с пчелами южных регионов и содержат максимальный уровень интрогрессии южных генов в ядерном геноме.Вторая подгруппа объединила локальные популяции пчел 17 районов Урала и Поволжья: Чекмагушевскую, Куюргазинскую, Хайбуллинскую, Кирово-Чепецкую, Уфимскую, Чишминскую, Учалинскую, Мелеузовскую, Красноуфимскую, Даровскую, Зилаирскую, Ишимбайскую, Гафурийскую, Белебеевскую, Баймакскую, Альшеевскую, Абзелиловскую. Эта группа объединила гибридные популяции темной лесной пчелы, которые генетически более близки с популяциями южных подвидов и содержат высокий уровень интрогрессии южных генов в ядерном геноме. Третья подгруппа объединила локальные популяции пчел 12 районов Урала и Поволжья: Чебоксарскую, Добрянскую, Усольскую, Иглинскую, Кукморскую, Белорецкую, Можгинскую, Кушнаренковскую, Караидельскую, Бирскую, Завьяловскую, Шарканскую. Эта группа объединила гибридные популяции темной лесной пчелы, которые генетически близки с аборигенными популяциями A. m. mellifera и содержат небольшой уровень интрогрессии южных генов в ядерном геноме. Четвертая подгруппа объединила локальные популяции пчел 16 районов Урала и Поволжья: Бурзянскую, Уинскую, Красновишерскую, Осинскую, Юсьвенскую, Нытвенскую, Частинскую, Янаульскую, Камбарскую, Пермскую, Ординскую, Малопургинскую, Мишкинскую, Якшур-Бодьинскую, Татышлинскую, Балтачевскую. Эта группа объединила аборигенные популяции темной лесной пчелы A. m. mellifera и содержат минимальный уровень интрогрессии южных генов в ядерном геноме. Популяции пчел этой группы генетически отдалены от популяций южных подвидов и являются основным ядром сохранения аборигенного генофонда A. m. mellifera Урала и Поволжья. Самой важной и наиболее наглядной оценкой при генотипировании семей пчел является оценка уровня интрогрессии южных генов в геноме темной лесной пчелы, поскольку результаты этого анализа позволяют принимать решение о направленности селекции. Понятие гибридизация и интрогрессия хоть и сходны между собой, но все же отличаются. При гибридизации происходит простое объединение отцовского и материнского генома разных подвидов в одном генотипе гибридного потомства, то есть гомологичные хромосомы будут от разных родителей. В случае интрогрессии смешивание генома происходит на более глубоком уровне и в геном темной лесной пчелы гены интегрируются не в виде гомологичных хромосом, а в виде вставок участков хромосом в результате обмена участками при кроссинговере. Интрогрессия представляет для генома темной лесной пчелы большую опасность, поскольку избавиться от таких внедрившихся во все хромосомы чужеродных фрагментов ДНК практически невозможно. Следует отметить, что интрогрессия происходит только на уровне ядерного генома, в то время как митохондриальный геном наследуется потомством в чистом виде без смешивания по материнской линии. Потому митохондриальный геном в анализе уровня интрогрессии применяется только на популяционном уровне и неинформативен на уровне отдельно взятых пчелиных семей. Редким исключением является гетероплазмия - когда зигота может сформироваться при участии материнского и отцовского митохондриального геномов, иногда передающихся сперматозоидами от трутней [Никоноров и др., 1998]. Оценку уровня интрогрессии южных генов в семьях пчел темной лесной пчелы популяций Урала и Поволжья, а также в семьях карпатской и серой горной кавказской пчел популяций Северного Кавказа и Восточных Карпат мы выполнили на основе данных по полиморфизму 9 микросателлитных локусов ap243, 4a110, A24, A8, A43, A113, A88, Ap049, A28 с использованием программы STRUCTURE 2.3.4 [Pritchard et al., 2000]. На основе Баейсовского анализа (Bayesian analysis) с применением метода кластеризации Монте-Карло с цепями Маркова (Monte Carlo Markov Chain) (MCMC) [Pritchard et al., 2000] при заданном числе кластеров K=2 с использованием модели смешивания (Admixture model) и повторности MCMC (iteration) 5000 были рассчитаны процентные значения интрогрессии генов эволюционной ветви C (A. m. caucasica) в семьях пчел эволюционной ветви M (A. m. mellifera) (таб. 5). На основе результатов кластерного Баейсовского анализа нами был построен график в виде гистограммы (plot), отражающий уровень интрогрессии для каждой особи из каждой отобранной семьи пчел в локальной популяции (рис. 2). Как мы можем наблюдать по рисунку 2, максимальное сохранение чистого генофонда темной лесной пчелы (эволюционная ветвь М) (максимум темных полосок) наблюдается в локальных популяциях пчел 20 районов Урала и Поволжья: Балтачевской, Бурзянской, Кушнаренковской, Мишкинской, Татышлинской, Янаульской, Ординской, Частинской, Нытвенской, Осинской, Пермской, Юсьвенской, Красновишерской, Усольской, Добрянской, Мамадышской, Малопургинской, Камбарской, Якшур-Бодьинской, Чебоксарской. В локальных популяциях пчел 12 районов Урала и Поволжья: Белорецкой, Гафурийской, Зилаирской, Иглинской, Ишимбайской, Караидельской, Чекмагушевской, Уинской, Красноуфимской, Кукморской, Завьяловской, Кильмезской около половины пасек оказались с высоким уровнем чистоты генофонда темной лесной пчелы, а половина пасек характеризовались сильным уровнем интрогрессии генов южных подвидов. Максимальный уровень интрогрессии генов южных подвидов наблюдались в локальных популяциях пчел 17 районов Урала и Поволжья: Абзелиловской, Альшеевской, Баймакской, Белебеевской, Бирской, Куюргазинской, Мелеузовской, Уфимской, Учалинской, Чишминской, Хайбуллинской, Нижнекамской, Шарканской, Можгинской, Кирово-Чепецкой, Даровской, Орловской. Для сравнения были взяты локальные популяции карпатской и серой горной кавказской пчел из 3 районов популяций Северного Кавказа и Восточных Карпат, которые на рисунке 2 были окрашены в желтый цвет и характеризовались почти 100% содержанием генома подвидов пчел эволюционной ветви С. Рисунок 2. График, отображающий уровень интрогрессии в локальных популяциях пчел Урала и Поволжья, а также Северного Кавказа и Восточных Карпат, где черный цвет характеризует содержание генома A. m. mellifera, а серый цвет - A. m. caucasica и A. m. carpatica, построенный на основе анализа полиморфизма 9 микросателлитных локусов Ap243, 4a110, A24, A8, A43, A113, A88, Ap049 и A28 ядерной ДНК. Для получения более подробной и точной информации о величине интрогрессии на уровне популяций нами было проведено сравнение данных ядерного и митохондриального геномов. Мы рассчитали содержание геномов М и С в локальных популяциях пчел 52 районов c помощью программы STRUCTURE 2.3.4 [Pritchard et al., 2000] (табл. 5). Цифровые численные значения уровня интрогрессии позволяют более четко увидеть различия уровня интрогресии, а также дают возможность рассчитать средние значения для нескольких локальных популяций определенного региона. На гистограммах достаточно сложно отобразить очень низкие уровни интрогрессии, поскольку полосок практически не будет видно. А цифровые значения легко увидеть, оценить и использовать для дальнейшего сравнительного анализа. Таблица 5 Содержание генофонда эволюционных ветвей M и С в локальных популяциях пчел 52 районов, рассчитанные на основе анализа полиморфизма 9 микросателлитных локусов Ap243, 4a110, A24, A8, A43, A113, A88, Ap049 и A28 ядерной ДНК и локуса COI-COII мтДНК Ядерный геном Митохондриальный геном Эволюционная ветвь Локальная популяция M C M (PQQ+PQQQ) C (Q) Абзелиловская 0,23 0,77 0,37 0,63 Альшеевская 0,21 0,79 0,31 0,69 Баймакская 0,34 0,66 0,57 0,43 Балтачевская 0,98 0,02 1,00 0,00 Белебеевская 0,36 0,64 0,44 0,56 Бирская 0,75 0,25 0,79 0,21 Бурзянская 0,96 0,04 1,00 0,00 Белорецкая 0,62 0,38 0,63 0,37 Гафурийская 0,35 0,66 0,40 0,60 Зилаирская 0,30 0,70 0,54 0,46 Иглинская 0,62 0,38 0,75 0,25 Ишимбайская 0,35 0,65 0,50 0,50 Караидельская 0,80 0,20 0,86 0,14 Кушнаренковская 0,86 0,14 0,92 0,08 Куюргазинская 0,08 0,92 0,15 0,85 Мелеузовская 0,12 0,88 0,15 0,85 Мишкинская 0,93 0,07 0,95 0,06 Татышлинская 0,97 0,03 0,99 0,02 Янаульская 0,98 0,02 1,00 0,00 Уфимская 0,36 0,64 0,47 0,53 Учалинская 0,19 0,81 0,20 0,80 Чишминская 0,17 0,83 0,20 0,80 Чекмагушевская 0,61 0,39 0,61 0,39 Хайбуллинская 0,06 0,94 0,13 0,87 Уинская 0,85 0,15 0,85 0,15 Ординская 0,95 0,05 0,96 0,04 Частинская 0,99 0,01 1,00 0,00 Нытвенская 0,99 0,01 1,00 0,00 Осинская 0,99 0,01 1,00 0,00 Пермская 0,93 0,07 0,95 0,05 Юсьвенская 0,99 0,01 1,00 0,00 Красновишерская 0,99 0,01 1,00 0,00 Усольская 0,97 0,03 1,00 0,00 Добрянская 0,96 0,04 1,00 0,00 Красноуфимская 0,31 0,70 0,26 0,74 Кукморская 0,60 0,41 0,58 0,42 Нижнекамская 0,16 0,85 0,67 0,33 Мамадышская 0,97 0,03 1,00 0,00 Малопургинская 0,92 0,08 0,92 0,08 Шарканская 0,79 0,21 0,79 0,21 Камбарская 0,98 0,02 1,00 0,00 Можгинская 0,99 0,01 1,00 0,00 Завьяловская 0,64 0,36 0,62 0,39 Якшур-Бодьинская 0,90 0,10 0,91 0,09 Чебоксарская 0,98 0,02 1,00 0,00 Кирово-Чепецкая 0,23 0,77 0,70 0,30 Даровская 0,37 0,63 0,50 0,50 Орловская 0,53 0,48 1,00 0,00 Кильмезская 0,94 0,06 1,00 0,00 Майкопская 0,01 0,99 0,00 1,00 Сочинская 0,01 0,99 0,00 1,00 Мукачевская 0,01 0,99 0,00 1,00 На основании полученных частот геномов М и С были построены гистограммы, характеризующие ядерный и митохондриальный геномы, позволяющие наглядно увидеть уровень интрогрессии в популяции и сопоставить их между собой (рис. 3). Такой подход позволяет контролировать отцовскую и материнскую наследственность пчелиных семей на пасеках. Для большинства изученных нами популяций пчел 52 районов показатели интрогрессии по ядерному и митохондриальному геномам близки. Содержание в популяциях более 20% генома подвидов пчел эволюционной ветви С по ядерному и митохондриальному геномам характеризует равную величину потока южных генов по отцовской и материнской линии и свидетельствует о постоянном непрекращающемся импорте пчелиных семей южных подвидов A. m. carpatica и A. m. caucasica. Минимальный уровень интрогрессии менее 5% по ядерному и митохондриальному геномам отмечался в локальных популяциях пчел 16 районов Урала и Поволжья: Ординской, Бурзянской, Добрянской, Татышлинской, Мамадышской, Усольской, Янаульской, Чебоксарской, Камбарской, Балтачевской, Красновишерской, Осинской, Частинской, Можгинской, Юсьвенской, Нытвенской. Рис. 3. Гистограммы, отражающие уровень интрогрессии в локальных популяциях пчел 52 районов по ядерному и митохондриальному геномам, построенные на основе анализа полиморфизма 9 микросателлитных локусов Ap243, 4a110, A24, A8, A43, A113, A88, Ap049 и A28 ядерной ДНК и локуса COI-COII мтДНК. Средний уровень интрогрессии до 20% по ядерному и митохондриальному геномам отмечался в локальных популяциях пчел 8 районов Урала и Поволжья: Караидельской, Уинской, Кушнаренковской, Якшур-Бодьинской, Малопургинской, Мишкинской, Пермской, Кильмезской. Максимальный уровень интрогрессии от 20% до 96% по ядерному и митохондриальному геномам отмечался в локальных популяциях пчел 15 районов Урала и Поволжья: Хайбуллинской, Куюргазинской, Мелеузовской, Чишминской, Учалинской, Абзелиловской, Красноуфимской, Гафурийской, Кукморской, Чекмагушевской, Иглинской, Белорецкой, Завьяловской, Бирской, Шарканской. В эту же группу вошли локальные популяции пчел 10 районов Урала и Поволжья: Нижнекамской, Альшеевской, Кирово-Чепецкой, Зилаирской, Баймакской, Ишимбайской, Белебеевской, Уфимской, Даровской, Орловской, для которых уровень интрогрессии по митохондриальному геному был ниже уровня интрогрессии по ядерному геному. Это показатель влияния трутневого фона семей южных подвидов, завозимых в соседние популяции. Локальные популяции пчел подвидов A. m. caucasica и A. m. carpatica 3 районов Северного Кавказа и Восточных Карпат: Краснодарской, Мукачевской, Майкопской характеризовались 100% содержанием генов южных подвидов (эволюционная ветвь С) по митохондриальному и ядерному геномам. Для проведения геногеографического анализа, позволяющего проследить географическое распространение генов подвидов пчел эволюционных ветвей M и C и определить ареал сохранившихся резерватов A. m. mellifera мы сделали их географическую привязку на карте (рис. 4). На территории Урала и Поволжья гены подвидов пчел эволюционных ветвей М и С распределяются не равномерно. Можно отметить, что содержание генов подвидов пчел эволюционной ветви М по ядерному и митохондриальному геномам возрастают в направлении северных широт, тогда как содержание генов подвидов пчел эволюционной ветви С возрастают в направлении южных широт. Также следует отметить, что основная масса сохранивихся популяций темной лесной пчелы эволюционной ветви М концентрируется в Предуралье, а в западном направлении возрастает концентрация южных генов эволюционной ветви С. Рис. 4. Географическая встречаемость генов южных подвидов эволюционной ветви С в локальных популяциях темной лесной пчелы эволюционной ветви М Урала и Поволжья, полученная на основе анализа полиморфизма 9 микросателлитных локусов Ap243, 4a110, A24, A8, A43, A113, A88, Ap049 и A28 ядерной ДНК и локуса COI-COII мтДНК. Это можно объяснить большей приспособленностью темной лесной пчелы A. m. mellifera к экстремально холодным и продолжительным зимовкам, по сравнению с A. m. caucasica и A. m. carpatica. Разный уровень приспособленности подвидов пчел эволюционных ветвей М и С к условиям окружающей среды Урала и Поволжья приводит к различиям в выживаемости и фиксации генов в популяции - пчелиные семьи южных подвидов в критических условиях Урала и Поволжья элиминируются значительно чаще семей аборигенных пчел, что и приводит к неравновесию в распределении генов. Другая причина данного неравномерного распределения генов пчел эволюционных ветвей М и С заключается в антропогенных факторах окружающей среды: пчеловоды северных широт, Урала и Поволжья, заинтересованы в разведении аборигенных темных лесных пчел, поэтому импорт южных подвидов пчел в эти регионы ограничен. Пчеловоды южных широт имеют другое мнение и отдают предпочтение южным подвидам пчел - A. m. caucasica и A. m. carpatica. Это предпочтение южных пчел объясняется тем, что разведение пчел с постоянной покупкой дешевых семей пчел южных подвидов из Оренбургской и Челябинской областей без обеспечения им зимовки, с уничтожением их осенью, оказывается экономически выгоднее содержания аборигенных пчелиных семей с обеспечением их полноценной зимовкой. Данный тип пчеловодства ориентирован только на получение больших объемов меда и не несет заботы о селекции и сохранении генофонда местных пчел. Многие пчеловоды Урала и Поволжья предпочитают разводить пчелиные семьи южных подвидов по причине их меньшей агрессивности по отношению к пчеловоду, а также дешевизны их рыночной стоимости, по сравнению с семьями темной лесной пчелы. Однако они, по причине отсутствия знаний, не могут представить себе все последствия своего выбора - их пасеки становятся источником распространения генов южных подвидов посредством трутней в окружающую популяцию темной лесной пчелы. Таким образом, нами было проведено молекулярно-генетическое исследование локальных популяций темной лесной пчелы A. m. mellifera эволюционной ветви М 49 районов Урала и Поволжья в сравнении с локальными популяциями пчел южных подвидов A. m. caucasica и A. m. carpatica эволюционной ветви С 3 районов Северного Кавказа и Восточных Карпат на основе анализа полиморфизма 9 микросателлитных локусов Ap243, 4a110, A24, A8, A43, A113, A88, Ap049 и A28 ядерной ДНК и локуса COI-COII мтДНК. Мы обнаружили на территории 16 районов Урала и Поволжья сохранившиеся резерваты аборигенной темной лесной пчелы A. m. mellifera с гибридизацией менее 5%. Результаты исследований подтверждают существование ранее выделенных 4 популяций темной лесной пчелы на Урале и дополняют данные о популяциях пчел Поволжья. Первая популяция темной лесной пчелы «бурзянская» включает локальную популяцию пчел A. m. mellifera Бурзянского района Республики Башкортостан. Вторая популяция темной лесной пчелы «татышлинская» включает локальные популяции пчел A. m. mellifera Татышлинского, Янаульского, Балтачевского районов Республики Башкортостан. Третья популяция темной лесной пчелы «южно-прикамская» включает локальные популяции пчел A. m. mellifera Ординского, Добрянского, Осинского, Частинского, Нытвенского районов Пермского края. Четвертая популяция темной лесной пчелы «вишерская» включает локальные популяции пчел A. m. mellifera Красновишерского, Усольского, Юсьвенского районов Пермского края. Пятая популяция темной лесной пчелы «камбарская» включает локальные популяции пчел A. m. mellifera Камбарского, Можгинского районов Республики Удмуртия. Кроме перечисленных пяти популяций темной лесной пчелы на территориях Мамадышского района Республики Татарстан и Чебоксарского района Республики Чувашия имеются несколько пасек с очень низким уровнем интрогрессии. Мы надеемся, что наши дальнейшие, более масштабные, исследования пчел этих районов позволят присвоить популяциям пчел этих районов статусы шестого и седьмого резерватов темной лесной пчелы A. m. mellifera Урала и Поволжья. Таким образом, на Урале и в Поволжье сохранились, по крайней мере, 5 локальных популяций темной лесной пчелы A. m. mellifera: бурзянская (горнолесная зона Республики Башкортостан), татышлинская (север Республики Башкортостан), южно-прикамская (юг и центр Пермского края), вишерская (север Пермского края), камбарская (юг и центр Республики Удмуртия). Эти пять локальных популяций (резерватов) составляют основу генофонда темной лесной пчелы Урала и Поволжья. В локальных популяциях пчел на территории 8 районов Урала и Поволжья наблюдалась умеренная гибридизация до 20%. Основной массив сохранившегося аборигенного генофонда A. m. mellifera (ядро генофонда популяции A. m. mellifera) располагается на территории всего Пермского края и Севера Республики Башкортостан. Для локальной популяции пчел A. m. mellifera Урала и Поволжья были рассчитаны средние значения гетерозиготности (Hо = 0,340 ± 0,037, Hs = 0,357 ± 0,032, Ht = 0,421 ± 0,037), коэффициенты инбридинга (Fis = 0,081 ± 0,037, Fit = 0,196 ± 0,042, Fst = 0,125 ± 0,023, коэффициенты родства (R = 0,210 ± 0,034). Для локальных популяций пчел A. m. caucasica и A. m. carpatica 3 районов Северного Кавказа и Восточных Карпат были рассчитаны средние показатели гетерозиготности (Hо = 0,192 ± 0,041, Hs = 0,253 ± 0,054, Ht = 0,320 ± 0,072), коэффициенты инбридинга (Fis = 0,268 ± 0,082, Fit = 0,517 ± 0,119, Fst = 0,340 ± 0,145, коэффициенты родства (R = 0, 459 ± 0,171). Эти генетические стандарты современной популяции темной лесной пчелы A. m. mellifera Урала и Поволжья, а также пчел A. m. caucasica и A. m. carpatica Северного Кавказа и Восточных Карпат могут быть использованы в сравнительном анализе с популяциями темной лесной пчелы других регионов. Популяцию темной лесной пчелы Урала и Поволжья в целом можно охарактеризовать следующим образом. Популяция не имеет больших различий с зарубежными популяциями A. m. mellifera и характеризуется оптимальными сбалансированными генетическими показателями. Популяция характеризуется небольшим дефицитом гетерозигот на уровне пасек и на уровне всей популяции, который характеризует как наличие генетико-стохастических процессов, так и искусственной селекции. Популяция имеет генетическую подразделенность, что свидетельствует о наличии изоляции между субпопуляциями, предотвращающей свободную миграцию особей и обеспечивающей накопление генетического разнообразия. Популяция характеризуется наличием небольшого инбридинга, что свидетельствует о преобладании близкородственных скрещиваний, что вызвано особенностями их содержания на пасеках. В популяции преобладают пчелиные семьи, находящиеся в родственных друг с другом отношениях, что показывает наличие селекции, ассортативности скрещивания и возможные генетико-стохастические процессы. В целом популяция темной лесной пчелы Урала и Поволжья обладает достаточно стабильной и сбалансированной генетической и генотипической структурой и характеризуется небольшим отклонением в распределении частот генотипов от равновесного распределения по Харди-Вайнбергу, что является также нормой и стандартом для популяций темной лесной пчелы A. m. mellifera. Значительное сходство стандартных генетических показателей популяции темной лесной пчелы Урала и Поволжья с показателями европейских популяций темной лесной пчелы подтверждают единство генофонда всех популяций A. m. mellifera Европы и России. Это дает возможность для разработки единой международной программы сохранения генофонда темной лесной пчелы и создания крупных резерватов темной лесной пчелы международного масштаба на изолированных территориях, например в Сибири.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз