Роль гена в регуляции роста органов табака role of the gene in the regulation of growth of tobacco organs

Авторы:
Кулуев Kuluev Б.Р.; B.R. , Сафиуллина; Safiullina М.Г.; M.G. , Князев; Knyazev А.В.; A.V. , Никоноров Ю.М.; Nikonorov; Y.M. , Чемерис А.В.; Chemeris; A.V.
Название:
Роль гена в регуляции роста органов табака role of the gene in the regulation of growth of tobacco organs
Страницы:
1-12
скачано
36 раз(а)


Проведен анализ уровня экспрессии гена NtEXPA6 в растениях табака при экзогеннойобработке фитогормонами и действии NaCl, а также получены трансгенные растения табака с конститутивной и индуцибельной экспрессией данного гена. В табаке дикого типа наиболее высокое содержание мРНК гена NtEXPA6 обнаруживалось в корнях и во вторых от верхушки побега листьях, причем в этих листьях повышение уровня экспрессии исследуемого гена индуцировали ауксины и цитокинины. В третьем от верхушки побега листе повышению уровня экспрессии гена NtEXPA6 способствовали лишь брассиностероиды. В молодых листьях расположенных ниже четвертого от верхушки побега листа, экспрессия гена NtEXPA6 не проявлялась даже при экзогенной обработке фитогормонами. Конститутивная и индуцибельная экспрессия исследуемого гена способствовали изменениям размеров органов и отдельных клеток трансгенных растений. The analysis of expression level NtEXPA6 gene in tobacco plants treated with exogenous phytohormonesand effect NaCl, as well as created transgenic tobacco plants with constitutive and inducible expression of the gene. In wild-type tobacco highest content of NtEXPA6 mRNA detected in the roots and in the second from the shoot apex leaves, and these leaves increase in the level of expression of the gene under study induced auxins and cytokinins. In the third of the shoot apex leaf increase expression level NtEXPA6 gene contributed only brassinosteroids. In young leaves located below the fourth leaf from the shoot apex, expression NtEXPA6 gene not apparent even when treated with exogenous phytohormones. Constitutive and inducible expression of the gene under study contributed to changes in the size of individual cells and organs of transgenic plants.
Введение Создание трансгенных растений с улучшенными параметрами роста представляет большой интерес для растениеводства и лесоводства. Одним из путей получения таких растений, являются манипуляции с уровнем экспрессии белков, участвующих в регуляции и обеспечении роста клеток растяжением (Кулуев и др., 2012). Расхождение микрофибрилл целлюлозы при клеточном растяжении достигается тремя основными механизмами: гидролизом части связующих гликанов эндогликаназами; разрезанием и новым сшиванием гликанов ксилоглюканэндотрансгликозилазами; а также нарушением водородных связей между микрофибриллами целлюлозы и гликановыми цепями, которое осуществляется экспансинами (Горшкова, 2007). Имеются сведения, что активность экспансинов определяется транскрипцией, а она, в свою очередь, тонко регулируется фитогормональным сигналингом и условиями внешней среды (Шарова, 2007). В каждом растении присутствует большое количество разнообразных экспансинов, при этом определение функций каждого из них по отдельности остается весьма важной, но до сих пор не выполненной задачей даже для модельного объекта Arabidopsis thaliana. В настоящее время проведено множество исследований, показывающих корреляции между экспрессией генов экспансинов и изменением размера вегетативных органов (Гао и др., 2010; Jung et al., 2010; Lin et al., 2011). Показано, что гены экспансинов могут быть использованы для создания трансгенных растений с увеличенными размерами органов (Cho, Cosgrove 2000; Gray- Mitsumune et al., 2008). Исследования показывают, что уровень экспрессии экспансинов также связан с адаптацией растений к экологическим стрессам через регулирование роста клеток растяжением (Гао и др., 2010). Например, у трансгенных растений табака, с повышенной экспрессией гена экспансина TaEXPB23, наблюдалась повышенная по сравнению с контролем устойчивость к солевому стрессу, которая достигалась путем повышения способности задержания воды и снижения осмотического потенциала (Han et al., 2012). При создании трансгенных растений одним из излюбленных исследователями модельных объектов является табак, у которого пока идентифицированы только шесть генов α- экспансинов (Link, Cosgrove, 1998). Судя по данным филогенетического анализа (Gray- Mitsumune et al., 2004), экспансины табака NtEXPA1, NtEXPA2 и NtEXPA3 относятся к подгруппе D, NtEXPA4 к подгруппе С, NtEXPA5 к подгруппе B, а NtEXPA6 относится к подгруппе A. Вероятнее всего, экспансины входящие в одну и ту же подгруппу выполняют одинаковую функцию. Ранее нами были начаты исследования генов некоторых экспансинов табака (Кулуев и др., 2014), однако ген NtEXPA6 оставался до сих пор неизученным. В связи с этим, целью данной работы являлось изучение профиля экспрессии исследуемого гена в различных органах при действии фитогормонов и NaCl, а также создание трансгенных растений табака с повышенным уровнем экспрессии гена NtEXPA6 и морфофизиологический анализ полученных растений. Материал и методы Экзогенная обработка табака фитогормонами, солевой стресс и количественная ОТ-ПЦР Перед экзогенной обработкой фитогормонами контрольные и опытные растения Nicotiana tabacum L. сорта Petit Havana линии SR1 в течение 55-ти дней выращивали на универсальном грунте (“Terra vita”, Россия) и опрыскивали всю надземную часть растения раствором фитогормона с добавлением твина (0,1%). Использовали следующие концентрации фитогормонов: 6-БАП - 50 мкМ, НУК - 0,5 мкМ, 24-эпибрассинолид - 0,1 мкМ, гибберелловая кислота (ГК3) - 1 мкМ. Контрольные растения опрыскивали 0,1% раствором твина. Через 1,5 часа после опрыскивания вторые и третьи от верхушки побега листья табака замораживали в жидком азоте, выделяли из них тотальную РНК с тризолом, а первую цепь кДНК строили при помощи олиго(dT) праймера и MMuLV-ревертазы (NEB, США). Чтобы вызвать солевой стресс, табак дикого типа вначале проращивали на универсальном грунте “Terra vita” в течение 30 дней, затем корни отмывали от почвы и растения выращивали на гидропонике (10% раствор Хогланда-Арнона) в течение пяти дней. Далее растения инкубировали в течение двух часов при различных концентрациях NaCl (0,1%, 0,5%, 1%, 1,5%, 2%, 5%), фиксировали их в жидком азоте и выделяли РНК из третьего от верхушки побега листа каждого растения. С целью определения уровня транскрипции исследуемого гена в различных органах при нормальных условиях и без обработки фитогормонами, выделяли тотальную РНК из соответствующих органов табака дикого типа, которые предварительно также проращивались на среде МС в течение 20 дней, а затем в универсальном грунте 55 дней. Для всех экспериментов по анализу уровня транскрипции брались листья из трех различных растений (число биологических повторностей равно 3). Для количественного анализа уровня транскрипции гена NtEXPA6 использовали праймеры ACAATCAATGGTTTCCGTTACTTCAA и CAATGGGCTGGCGCAATGTTC, а для ОТ-ПЦР гена NtEXPA4 праймеры TGTAATCCTCCCCTTCACCAT и ATAATTGTTGTTTTGCCAGTTTTG. T Количественное определение содержания мРНК (после конверсии в кДНК) гена NtEXPA6 проводили методом полимеразной цепной реакции в режиме реального времени в присутствии интеркалирующего красителя SYBR Green I на термоциклере Rotor-GeneTM 6000 (Corbett Research, Австралия). Расчеты производились по 2-∆∆С методу (Livak, Schmittgen, 2001), используя в качестве стандарта мРНК тубулина, уровень экспрессии которого принимали за 100%. Для ОТ- ПЦР гена α-тубулина табака использовали праймеры CCAAGGTGCAAAGGGCTGTAT и TTCCTCGTTATCATCGTCTTCTCC. Генно-инженерные манипуляции Полноразмерный ген NtEXPA6 (AF049355) был амплифицирован из геномной ДНК табака при помощи праймеров TTATGCTTTGCCTAATGACA и TGTGTTACTAATCACTTCAATACTC и HiFi ДНК-полимеразы (Kapa Biosystems, США), размер ампликона при этом составил около 1700 п.н. При создании генно-инженерных конструкций использовали бинарный вектор pCambia 1301 (CAMBIA, Австралия), с селективным маркером устойчивости к гигромицину, в котором нами была клонирована искусственно созданная кассета, состоящая из промотора вируса мозаики георгина (Кулуев и др., 2007) и сайта полиаденилирования вируса мозаики цветной капусты. Полученную плазмиду расщепляли по сайту рестрикции XbaI, достраивали липкие концы при помощи Т4-ДНК полимеразы и в полученном бинарном векторе клонировали ген NtEXPA6. Трансгенные растения табака с эстрадиол-индуцибельной экспрессией гена NtEXPA6 получали при помощи бинарного вектора pER8, содержащего ген устойчивости к гигромицину, химерный транскрипционный активатор XVE и сильный промотор G10-90 (Zuo et al., 2000). Бинарный вектор pER8 расщепляли по сайту рестрикции XhoI, достраивали липкие концы при помощи Т4-ДНК полимеразы и в полученном векторе клонировали целевой ген. Получение трансгенных растений табака, их морфологическая характеристика и условия выращивания растений Трансгенные растения табака Nicotiana tabacum L. сорта Petit Havana линии SR1 получали методом агробактериальной трансформации листовых дисков, высеченных из листьев трехмесячных растений (Кулуев и др., 2013). Растения трансгенных линий и контрольные растения культивировали в вегетационных сосудах объемом 450 мл, заполненных универсальным грунтом “Terra vita” в условиях теплицы при температуре 25-27°С с освещенностью около 140 ммоль на кв. м в сек и фотопериодом 16/8 часов (свет/темнота). В качестве контрольных использовали нетрансгенные растения табака сорта Petit Havana линии SR1, выращенные на среде МС без добавления антибиотиков и акклиматизированные к условиям почвы. Также для контроля использовали трансгенные растения, содержащие Т-ДНК бинарного вектора pCambia 1301 без целевого гена. Морфологический анализ проводили в период цветения. Для каждой линии было отобрано по пять растений (число биологических повторностей равно 5), у которых измеряли три нижних листа в длину (первый, второй и третий настоящие листья), длину стебля и пяти цветков. Для определения средней площади клеток нижнего эпидермиса листьев и наружного эпидермиса цветков со средней части трех нижних листьев и трех цветков отбирали слой эпидермиса площадью около 0,5-1 см2. Измерения проводили при помощи универсального флуоресцентного микроскопа модели Axio Imager M1 (Carl Zeiss, Германия) с использованием оригинального программного обеспечения. Опытные трансгенные растения содержащие Т-ДНК вектора pER8 и ген NtEXPA6 обрабатывали 5 мкМ раствором βэстрадиола в ДМСО (Sigma, США), при этом контрольные растения опрыскивали 5 мкМ раствором ДМСО без эстрадиола. Через три часа после обработки эстрадиолом из третьего листа контрольных и опытных растений выделяли РНК и проводили полуколичественную ОТ-ПЦР для выяснения наличия экспрессии гена NtEXPA6. Далее все растения обрабатывали каждую неделю по два раза вплоть до стадии цветения и проводили морфологический анализ трансгенных растений. Для статистической обработки результатов использовали программы Statistica 6.0 и MS Excel 2003. Результаты исследования Определение филогенетического родства гена NtEXPA6 с экспансинами A. thaliana и Solanum lycopersicum Исходя из предположения, что сходные по нуклеотидному составу гены экспансинов могут выполнять одинаковые функции при регуляции роста клеток растяжением и развитии растения в целом, нами при помощи программы MegAlign (DNASTAR, США) был проведен филогенетический анализ шести генов экспансинов табака, 25 генов A. thaliana и 12 генов Solanum lycopersicum. Наибольшей схожестью по последовательности нуклеотидов с геном NtEXPA6 характеризовались гены AtEXPA4 и AtEXPA6 A. thaliana, а также LeEXPA1, LeEXPA9 и LeEXPA18 Solanum lycopersicum (рис. 1). Анализ уровня экспрессии гена NtEXPA6 в различных органах табака и при экзогенной обработке фитогормонами Во всех проанализированных органах табака уровень экспрессии гена NtEXPA6 был существенно ниже, того уровня, который демонстрировали гены NtEXPA1 и NtEXPA4 (Кулуев и др., 2014). Относительно высокое содержание мРНК гена NtEXPA6 было детектировано лишь в корнях, а также во втором и третьем от верхушки побега листьях табака дикого типа. В то же время исследуемый экспансин экспрессировался в молодых листьях и корнях всех проанализированных нами растений табака, что говорит о функциональной важности данного экспансина для роста органов. Максимальный уровень экспрессии гена NtEXPA6 был зафиксирован нами в корнях (рис. 2), однако во втором от верхушки побега листе содержание мРНК NtEXPA6 было также относительно высоким. При этом уже в третьих от верхушки побега листьях уровень экспрессии гена NtEXPA6 резко падал (рис. 2) и в растущих листьях более старшего возраста практически не определялся. Таким образом, экспрессия гена NtEXPA6 тесно связана с очень молодыми органами, которые находятся на стадии перехода к росту растяжением, а в листьях продолжающих интенсивный рост растяжением, уровень его экспрессии очень низок или вообще не определяется. Рис. 1. Филогенетическое древо сходства гена NtEXPA6 табака с гомологичными генами A. thaliana и S. lycopersicum. Рис. 2. Количественный анализ уровня транскрипции гена NtEXPA6 в различных органах табака, а также под влиянием экзогенной обработки фитогормонами. БАП - 6-бензиламинопурин, НУК - нафтилуксусная кислота, ЭБ - 24-эпибрассинолид и ГК3 - гибберелловая кислота. Данные представлены в виде среднего арифметического ± доверительный интервал (n=3, α=0,5). По оси ординат приведены значения относительного уровня экспрессии гена NtEXPA6 по отношению к содержанию мРНК гена α-тубулина, которое принято за 100%. Из литературы известно, что экспрессия различных экспансинов находится под контролем многих фитогормонов, но наибольший вклад вносят ауксины, цитокинины, брассиностероиды и гиббереллины (Шарова, 2007). Поэтому большой интерес представляет определение особенностей регуляции экспрессии гена NtEXPA6 этими фитогормонами и сравнение полученных результатов с данными литературы. Нами было показано, что во втором от верхушки побега листе экспрессия гена NtEXPA6 повышается лишь под влиянием 6-БАП и НУК (рис. 2), как и в случае с экспансинами NtEXPA1 и NtEXPA4 (Кулуев и др., 2014). Однако степень увеличения уровня экспрессии по сравнению с нашими предыдущими данными по другим экспансинам табака, для NtEXPA6 столь мала, что можно говорить о незначительном влиянии экзогенных фитогормонов на уровень экспрессии исследуемого экспансина. В то же время во втором листе нами зарегистрировано негативное действие 24-эпибрассинолида на уровень экспрессии гена NtEXPA6 (рис. 2). Интересно отметить, что сходное негативное действие данного фитогормона на уровень экспрессии экспансинов нами было показано ранее для гена NtEXPA1 (Кулуев и др., 2014). В третьем от верхушки побега листе уровень экспрессии гена NtEXPA6 снижается в среднем в три раза по сравнению со вторым листом. В данном случае на содержание мРНК гена NtEXPA6 положительное влияние оказывал только 24-эпибрассинолид (рис. 2), причем при воздействии этого фитогормона экспрессия гена NtEXPA6 повышалась в среднем в два раза. Следует заметить, что весьма схожие данные нами были получены ранее для гена NtEXPA4, экспрессия которого также повышалась в третьем листе под влиянием 24-эпибрассинолида (Кулуев и др., 2014). Полученные данные говорят о существовании довольно сложной системы тонкой регуляции транскрипции генов экспансинов в листьях, причем весьма важную роль при этом, вероятнее всего, играют и брассиностероиды, которые в отличие от цитокининов и ауксинов, способны как повышать, так и снижать уровень экспрессии экспансинов в зависимости от органа, стадии развития и гена- мишени. Анализ уровня экспрессии гена NtEXPA6 под влиянием стрессов, вызванных дефицитом влаги Одним из наиболее распространенных факторов среды, вызывающих дефицит влаги для растений, является избыточное содержание NaCl в почве. В литературе имеются сведения о повышении уровня экспрессии экспансинов под влиянием избыточной NaCl (Schipper et al., 2002). Нами также были проведены исследования уровня транскрипции ряда экспансинов табака под влиянием NaCl, и для нескольких белков этой группы, было показано повышение содержания их мРНК под влиянием избыточного содержания соли. Например, уровень содержания мРНК гена NtEXPA4 существенно повышался при содержании NaCl в среде от 0,1% до 2%, причем при дальнейшем повышении концентрации соли, содержание транскриптов данного экспансина увеличивалось в меньшей степени (рис. 3). Схожие данные нами были получены и для других экспансинов табака (неопубликованные данные), однако уровень экспрессии гена NtEXPA6 мало изменялся под влиянием NaCl и оставался на уровне контроля вплоть до очень высоких концентраций соли (рис. 3). Наиболее существенное повышение содержания мРНК гена NtEXPA6 (в два раза) наблюдалось при максимально использованной нами концентрации NaCl (рис. 3). Рис. 3. Количественный анализ уровня экспрессии генов NtEXPA4 и NtEXPA6 под влиянием NaCl. По оси ординат приведены значения относительного уровня экспрессии генов NtEXPA4 и NtEXPA6 по отношению к содержанию мРНК гена α-тубулина, которое принято за 100%. Интересно отметить, что в листьях табака, росших на почве, уровень экспрессии генов NtEXPA1 и NtEXPA4 был выше в среднем в два раза, чем в листьях табака, росших на гидропонике (данные не представлены), что также подтверждает участие экспансинов в регуляции устойчивости к стрессам, вызванным не только избытком NaCl, но и дефицитом влаги в целом. Однако экспрессия гена NtEXPA6 при выращивании на почве повышалась только в 1,5 раза по сравнению с гидропоникой. Особенности регуляции экспрессии экспансинов thaliana, гомологичных гену NtEXPA6 по данным NCBI GEO Исходя из данных NCBI GEO известно, что экспрессия генов AtEXPA4 и AtEXPA6 повышается под влиянием ауксинов, однако при одновременном использовании ауксинов и ингибитора биосинтеза брассиностероидов брассинозола, повышения экспрессии соответствующих экспансинов не наблюдается, что говорит о важном значении брассиностероидов в регуляции экспрессии данной группы экспансинов и тесном взаимодействии между сигнальными системами ауксинов и брассиностероидов. Сами брассиностероиды снижали экспрессию гена AtEXPA4, а на уровень экспрессии гена AtEXPA6 влияния практически не оказывали. У мутантов A. thaliana arf2, arf6 и arf8 также наблюдается снижение уровня экспрессии генов AtEXPA4 и AtEXPA6, что подтверждает важность ауксинового сигналинга при регуляции транскрипции этих экспансинов. Таким образом, результаты проведенного поиска информации из базы данных NCBI GEO показывает, что по профилю экспрессии в различных тканях и органах, а также под влиянием различных фитогормонов экспансины AtEXPA4 и AtEXPA6, весьма схожи между собой. Более того, экспрессия гена NtEXPA6, судя по нашим данным, также регулируется сходным с этими экспансинами образом. Несколько разная реакция генов AtEXPA4, AtEXPA6 и NtEXPA6 на брассиностероиды может свидетельствовать о том, что данная группа фитогормонов играет определяющую роль при тонкой регуляции экспрессии этих экспансинов. Конститутивная экспрессия гена NtEXPA6 под контролем промотора вируса мозаики георгина Значение экспансинов для роста клеток растяжением может быть доказано путем повышения уровня их экспрессии в трансгенных растениях (Cho, Cosgrove, 2000). Для решения этого вопроса нами были получены трансгенные растения табака, экспрессирующие ген NtEXPA6 под контролем промотора вируса мозаики георгина. Для сравнительного морфологического анализа были отобраны линии трансгенных растений под номерами 2, 4, 6, 7, 8, 9, 11, 12, 14 и 15, которые характеризовались более высоким по отношению к контролю (табак дикого типа) уровнем транскрипции гена NtEXPA6 и содержанием единичной копии трансгена. Морфологический анализ трансгенных растений показал, что по размеру листьев опытные растения мало отличаются от контрольных. Достоверное увеличение длины листьев было характерно только для линий 2, 8 и 11, причем разница с контролем обычно не превышала 11% (рис. 4а), что лишь немного превышает норму реакции табака (Кулуев и др., 2013). Увеличение площади листьев в среднем на 17% было характерно для линии 14 (рис. 4б), что превышает норму реакции табака. Достоверное увеличение высоты стебля было характерно для линий 8 и 11 (рис. 4в), причем для линии 8, например, разница с контролем оставляла 30%. По размеру цветка в среднем большинство линий опытных растений практически не различались между собой. Однако в выборках было довольно много растений с уменьшенными размерами цветков (рис. 5). В то же время, если сравнивать средние арифметические значения, то достоверное уменьшение размеров цветков было характерно только для линий 6 и 12, причем степень уменьшения для последней линии в среднем составила 4% (рис. 4г). Причем норма реакции для размеров цветков у табака в наших предыдущих исследованиях не превышала 1% (Кулуев и др., 2013). Микроскопический анализ показал, что некоторые линии опытных растений, особенно те, что отличались увеличением размеров листьев, характеризовались также и возрастанием размеров отдельных клеток нижнего эпидермиса (данные не представлены). Интересно отметить, что несмотря на уменьшение размеров цветков, многие трансгенные растения характеризовались небольшим увеличением размеров клеток эпидермиса венчика цветка (рис. 4д). Например, достоверное по сравнению с контролем увеличение размеров клеток эпидермиса цветков было характерно для линий 2, 4, 6. 9, 14, причем у линии 4 клетки были увеличены почти на 50%. Все эти данные говорят о том, что продукт гена NtEXPA6 хоть и является, скорее всего, минорным белком, все же оказывает заметное влияние на клеточное растяжение в надземных органах трансгенных растений (рис. 4д), что, вероятнее всего и способствует увеличению размеров отдельных клеток. Рис. 4. Сравнительный анализ трансгенных растений табака с конститутивной экспрессией гена NtEXPA6: а - длина листьев в период цветения, см; б - площадь листьев в период цветения, см2; в - высота стебля в период цветения, см; г - длина цветков, см, д - площадь клеток наружного эпидермиса венчика цветков, мкм2. SR1 - контрольные растения табака дикого типа. 1301 - контрольные трансгенные растения табака, содержащие Т-ДНК бинарного вектора pCambia 1301 без целевого гена. 2-15 - линии опытных растений табака, сверхэкспрессирующих ген NtEXPA6. Данные представлены в виде среднего арифметического ± доверительный интервал (n=5; α=0,5; * - p<0,05). Размеры клеток и органов исследованных нами трансгенных растений могли увеличиваться не только под влиянием повышения экспрессии гена NtEXPA6, но и за счет увеличения плоидности, например, при спонтанной стимуляции эндоредупликации (Sugimoto-Shirasu et al., 2005). Однако подсчет количества хлоропластов в устьичных клетках у контрольных и опытных растений, показал, что трансгенные растения являются диплоидными (Kudo, Kimura, 2002). Данный анализ свидетельствует о том, что увеличение площади клеток и изменения размеров вегетативных органов трансгенны х растений обусловлено, вероятнее всего, повышенной экспрессией гена NtEXPA6. Рис. 5. Сравнение размеров цветка контрольных растений дикого типа и трансгенных растений с конститутивной экспрессией гена NtEXPA6. Индуцибельная экспрессия гена NtEXPA6 под контролем транскрипционной системы XVE Причиной незначительного увеличения размеров органов, у трансгенных растений, сверхэкспрессирующих ген NtEXPA6, может быть не только небольшое значение его белкового продукта для роста растений или косупрессия трансгена, но и низкий уровень экспрессии целевого гена. Возможно, после агробактериальной трансформации эксплантов листьев трансгенные побеги с высоким уровнем экспрессии гена NtEXPA6 не выживали или даже не образовывались из-за негативного влияния белкового продукта трансгена на начальных стадиях развития растения. Одним из путей решения данной проблемы может стать использование при создании трансгенных растений индуцибельного промотора, вместо конститутивного. Исходя из этих соображений, в нашей работе для исследования влияния экспрессии гена NtEXPA6 на рост табака была также использована транскрипционная система XVE, где в качестве индуктора используется эстрадиол, являющийся гормоном животных и отсутствующий в растительных клетках (Zuo et al., 2000). Наши предварительные исследования показали, что эстрадиол, в используемых нами концентрациях, не оказывает заметного влияния на уровень транскрипции генов экспансинов и в частности гена NtEXPA6. Для постановки эксперимента, по результатам ПЦР, ОТ-ПЦР и анализа наследования и расщепления устойчивости к селективному агенту, были отобраны линии трансгенных растений под номерами 1, 3, 4, 6, 7, 8, 10, 11, 14, 15, 16 и 19, в которых экспрессия гена NtEXPA6 эффективно индуцировалась под влиянием эстрадиола. Морфологический анализ показал, что по размерам листьев контрольные и опытные растения различаются лишь незначительно, причем в линиях 3, 8, 10, 11 и 14 наблюдается достоверное уменьшение как длины листьев, так и их площади (рис. 6а, б). Увеличения размеров листьев у опытных растений нами не было зафиксировано ни для одной линии. В то же время для линий 1, 4, 7 и 19 было зарегистрировано достоверное увеличение высоты стебля по сравнению с контролем (рис. 6в). Уменьшение размеров стебля было характерно только для линий 6, 8 и 11. По длине цветка линии 1 и 19 характеризовались их увеличением, в то время как у линий 3 и 8 размеры цветков достоверно уменьшались по сравнению с контрольными растениями (рис. 6г). Итак, индуцибельная экспрессия гена NtEXPA6 довольно часто способствовала уменьшению размеров листьев, а иногда и цветков. В то же время размеры клеток эпидермиса листьев у опытных растений большинства линий были больше, чем у контрольных растений (рис. 6д). Результаты проведенного исследования показывают, что индуцибельная экспрессия гена NtEXPA6, стимулирует рост клеток растяжением, однако при этом размеры органов у табака довольно часто не только не увеличивались, но, вопреки ожиданиям, довольно часто уменьшались . Рис. 6. Сравнительный анализ трансгенных растений табака с индуцибельной экспрессией гена NtEXPA6: а - длина листьев, см; б - площадь листьев, см2; в - высота стебля, см; г - длина цветков, см.; д - площадь клеток нижнего эпидермиса листьев, мкм2. 1-19 - линии опытных растений табака, сверхэкспрессирующих ген NtEXPA6. Светлая колонка - контроль, темная колонка - опыт. Данные представлены в виде среднего арифметического ± доверительный интервал (n=5; α=0,5; * - p<0,05). Обсуждение Экспансины AtEXPA4, AtEXPA6, LeEXPA1, LeEXPA9, LeEXPA18 и NtEXPA6 относятся к одной группе А и вероятнее всего, выполняют в растениях весьма схожие, но неизвестные функции, так как перечисленные экспансины относятся к малоизученным. Судя по полученным нами результатам, в отличие от экспансина NtEXPA4, продукт гена NtEXPA6 скорее всего является минорным белком, причем как и NtEXPA1, необходим только в молодых органах, характеризующихся началом перехода к росту растяжением. Экспрессия гена NtEXPA6 также как и в случае с геном NtEXPA1, блокируется 24-эпибрассинолидом, однако у гена NtEXPA6 это происходит уже во втором от верхушки побега листе, тогда как в случае с геном NtEXPA1 только в третьем листе (Кулуев и др., 2014). В то же время говорить однозначно, что это связано с тем, что экспансин NtEXPA6 нужен только для инициации клеточного растяжения в молодых органах, тоже нельзя, так как в третьем листе брассиностероиды опять были способны стимулировать экспрессию исследуемого гена. Здесь можно сказать лишь о том, что брассиностероидами осуществляется, по видимому, более тонкая и сложная регуляция экспрессии экспансинов и в зависимости от стадии развития органа, эта группа фитогормонов может способствовать как увеличению (Park et al., 2010), так и уменьшению уровня экспрессии экспансинов (Кулуев и др., 2014). Согласно результатам наших исследований, ауксины и цитокинины обладали только стимулирующим эффектом на экспрессию гена NtEXPA6, что соответствует литературным данным, относящимся к другим экспансинам (Jung et al., 2010). В то же время из литературы хорошо известно о тесном взаимодействии сигнальных путей брассиностероидов, ауксинов и цитокининов (Nemhauser et al., 2004; Yuldashev et al., 2012) и полученные нами результаты поднимают вопрос о том, на каком уровне происходят эти взаимодействия и каковы их молекулярные механизмы. Цитокинины, как и в нашем предыдущем исследовании (Кулуев и др., 2014) в меньшей степени влияли на экспрессию экспансинов, чем ауксины, причем уже в третьем листе, эта группа фитогормонов переставала влиять на транскрипцию гена NtEXPA6. Интересно отметить, что листья более старшего возраста, чем третий от верхушки побега лист, вовсе перестают быть доступными для стимуляции транскрипции в них гена NtEXPA6 под влиянием экзогенной обработки фитогормонами, что говорит о существовании эпигенетических механизмов регуляции экспрессии экспансинов. Судя по литературным данным, необходимость в экспансинах возрастает не только при избытке в среде NaCl (Гао и др., 2010), но и при дефиците влаги вызванным нейтральным осмотиком ПЭГ (Sabirzhanova et al., 2005). Действительно ранее было показано, что при низкой концентрации влаги в почве наблюдается повышение уровня экспрессии гена ZmEXP1 кукурузы (Веселов и др., 2008), при этом быстрое возрастание транскрипционной активности этого гена предшествует возобновлению роста клеток листа растяжением в условиях недостаточности воды. В то же время экспансин NtEXPA6, по сравнению с другими экспансинами табака, играет, видимо, меньшую роль при регуляции роста клеток растяжением в условиях дефицита воды. Сверхэкспрессия экспансинов чаще всего способствует увеличению размеров органов (Cho, Cosgrove, 2000, Gray-Mitsumune et al., 2008, Кулуев и др., 2013), однако имеются данные и о негативном влиянии экспансинов на рост растений (Гао и др., 2010). Часть полученных нами трансгенных растений табака с конститутивной экспрессией гена NtEXPA6 характеризовались увеличением, прежде всего, размеров листьев и стебля, что еще раз подтверждает участие продукта данного гена в регуляции роста побега и косвенно доказывает функциональную полноценность белка NtEXPA6. Повышенная экспрессия гена NtEXPA6 негативно сказывалась лишь на росте цветков, а размеры листьев и стебля у одной части линий при этом увеличивались, а у другой части линий оставалась неизменными. При этом основной причиной увеличения размеров органов у опытных растений было изменение размеров отдельных клеток. Все эти данные хорошо соотносятся с нашими предыдущими результатами по морфологическому анализу трансгенных растений конститутивно экспрессирующих ген NtEXPA1 (Кулуев и др., 2014). В то же время при индуцибельной экспрессии исследуемого гена в первую очередь увеличивалась высота стебля, а не размеры листьев, что сближает гены NtEXPA5 и NtEXPA6 между собой (Кулуев и др., 2013). Пролонгирования роста листьев трансгенных растений при обработке их эстрадиолом не происходило, что, скорее всего, связано с уменьшенной восприимчивостью клеточных стенок к избытку экспансина у прекративших рост листьев. В отличие от генов NtEXPA1 и NtEXPA5 сверхэкспрессия гена NtEXPA6 довольно часто способствовала уменьшению размеров органов, что может быть связано с тем, что данный экспансин более существенно нарушает организацию клеточной стенки, чем другие экспансины, вызывая сильную дезорганизацию микрофибрилл целлюлозы, поэтому рост органов не усиливается, а наоборот, снижается (Гао и др., 2010), причем этим же может объяснятся низкий уровень экспрессии данного экспансина даже в молодых органах. Судя по всему, ген NtEXPA6, в отличие от некоторых других экспансинов табака, едва ли может быть использован для создания трансгенных растений с увеличенными размерами органов, так как его сверхэкспрессия довольно часто, вопреки ожиданиям, способствует уменьшению размеров листьев, стебля и цветков. Работа выполнена с привлечением приборного парка ЦКП «Биомика» Института биохимии и генетики Уфимского научного центра РАН и при финансовой поддержке Программы поддержки ведущих научных школ № НШ- 5923.2014.4.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз