КЛОНИРОВАНИЕ ФРАГМЕНТА ГЕНА МИСС-МАТЧ РЕПАРАЦИИ MSH2 ИЗ РАЗЛИЧНЫХ ВИДОВ ТОМАТОВ

Авторы:
Криницына А.А. , Комахин Р.А.
Название:
КЛОНИРОВАНИЕ ФРАГМЕНТА ГЕНА МИСС-МАТЧ РЕПАРАЦИИ MSH2 ИЗ РАЗЛИЧНЫХ ВИДОВ ТОМАТОВ
Страницы:
336-343
скачано
11 раз(а)


Система мисс-матч репарации поддерживает целостность генома путем коррекции неспаренных оснований, возникших в результате синтеза или повреждений ДНК, но ограничивает рекомбинацию между гомеологичными последовательностями ДНК. Подавление экспрессии гена мисс-матч репарации MSH2 может повысить частоту кроссинговера между хромосомами разных видов томатов. Для эффективной РНК-интерференции генов MSH2 у межвидовых гибридов необходимы знания об их нуклеотидных последовательностях в разных видах. В настоящей работе впервые установлены нуклеотидные последовательности, частично кодирующие II и IV, и полностью кодирующие III домены белка Msh2 у пяти дикорастущих видов томатов и культурного томата сорта «Марглоб». Показано наличие консервативной последовательности в III домене с ключевым остатком аргинина. Сравнение нуклеотидных и аминокислотных последовательностей подтвердило высокую степень консервативности генов MSH2. Обсуждаются возможности РНК-интерференции генов MSH2 за счет использования нового промотора pro-SmAMP2, высокая активность которого отмечена в репродуктивных органах трансгенных растений.
Введение Длительная селекция культурного томата Solanum lycopersicum L. исчерпала большую часть его биологического разнообразия. Донорами новых аллелей являются многочисленные дикорастущие виды томатов, которые скрещиваются с культурным томатом [Chetelat, Ji 2007]. У значительного числа межвидовых гибридов культурного и дикорастущих видов не обнаружено существенных нарушений синапсиса гомеологов и их сегрегации в мейозе, однако отмечено подавление кроссинговера, необходимого для формирования в потомстве рекомбинантов с кроссоверными хромосомами [Chetelat, Ji 2007]. Для запуска мейотического кроссинговера клетки по всему геному создают двухцепочечные разрывы (ДЦР) ДНК, репарация которых различными биохимическими путями используется для корректного завершения мейоза [Mézard et al., 2015]. Путь репарации ДЦР, известный как double-strand break repair, приводит к кроссинговерам, которые реализуются в виде обменов двухцепочечными участками ДНК между гомологами, и необходимы для их точной сегрегации в анафазе I [Page, Hawley, 2003]. В целом кроссинговеров между гомологами на порядок меньше, чем ДЦР [Basu-Roy et al., 2013]. Поэтому для поддержания целостности генома не преобразованные в кроссинговеры ДЦР репарируются либо по альтернативному пути synthesis-dependent strand annealing [McMahill et al., 2007], либо с использованием сестринской хроматиды в качестве матрицы [Goldfarb, Lichten, 2010], приводя к некроссоверным рекомбинационным продуктам. В случае кроссинговера или формирования некроссоверных рекомбинационных продуктов с использованием гомологов в качестве матрицы для репарации ДЦР возможно возникновение участков гетеродуплексной ДНК, содержащих неспаренные основания [Cole et al., 2012].  Система мисс-матч репарации (Mismatch Repair, MMR) обнаруживает и исправляет эти несоответствия, но из-за этой своей способности может разрушать гетеродуплексную ДНК при формировании кроссинговера и, таким способом, подавлять мейотическую рекомбинацию [Cole et al., 2012]. У отдаленных гибридов дрожжей (Saccharomyces cerevisiae х Saccharomyces paradoxus) мутация гена мисс-матч репарации MSH2 приводит к усилению мейотической рекомбинации и повышению жизнеспособности спор [Hunter et al., 1996], а у межлинейных гибридов арабидопсиса (Arabidopsis thaliana (L.) Heynh.) к усилению мейотического кроссинговера между гомологичными хромосомами [Emmanuel et al., 2006]. В то же время, исследования с использованием Arabidopsis не получили экспериментального продолжения на межвидовых гибридах, поскольку из-за различий в основном числе хромосом невозможно однозначно оценить влияние супрессии гена MSH2 на кроссинговер между гомеологами. Подавление с помощью РНК-интерференции или биосинтеза мутантного белка Msh2 экспрессии гена MSH2 у линии культурного томата с дополненной хромосомой 8 от дикорастущего вида Solanum lycopersicoides Dunal. позволило на 3.8-29.2 % повысить частоту кроссинговера между гомеологами [Tam et al., 2011]. Поскольку разные виды томатов содержат одинаковое число хромосом и неплохо скрещиваются друг с другом, а их межвидовые гибриды фертильны и в различной степени самосовместимы [Bedinger et al., 2011], то это дает основание использовать полученные ранее результаты для усиления кроссинговера между гомеологичными хромосомами непосредственно у межвидовых гибридов. Однако для реализации этой стратегии необходимо подавить экспрессию гена MSH2 у межвидовых гибридов томатов либо описанными выше методами [Tam et al., 2011], либо с использованием более современного метода геномного редактирования CRISPR/Cas [Кулуев и др., 2017]. В последнем случае необходимо редактирование (нокаут-мутация) гена MSH2 не только у культурного томата, но и у дикорастущего вида, с которым предполагается гибридизация с целью создания межвидовых гибридов с мутациями всех аллелей генов MSH2. В отличие от геномного редактирования, РНК-интерференция позволяет одновременно подавить экспрессию у межвидовых гибридов всех генов MSH2, однако для этого требуется выбрать в их последовательности идентичные участки, которые могут служить общей мишенью. Ранее из растений культурного томата изолировали полноразмерную нуклеотидную последовательность гена MSH2, методом молекулярного картирования показали, что этот ген существует в геноме в одной копии и располагается в хромосоме 6 [Tam et al., 2009]. Однако до настоящего времени нуклеотидные последовательности гена MSH2 у других видов томатов не были секвенированы. Целью наших исследований было установить нуклеотидные последовательности гена MSH2 у разных видов томатов и оценить возможность их использования для подавления его экспрессии у межвидовых гибридов. Материалы и методы В работе использовали суммарную РНК из молодых листьев (3.5 ± 0.5 см) растений Solanum habrohaites S. Knapp and D.M. Spooner, S. cheesmaniae (L. Riley) Fosberg, S. chilense (Dunal) Reiche, S. lycopersicum var. cerasiforme M. Spooner, G.J. Anderson  R.K. Jansen, S. corneliomuelleri J.F. Macbr и S. lycopersicum сорта «Марглоб». Выделение РНК и получение последовательностей кДНК целевых генов выполнили в соответствии с опубликованными ранее результатами, оптимизированными для томата [Комахин и др., 2010]. При получении кДНК использовали обратную транскриптазу M-MuLV согласно протоколу производителя («Thermo Fisher Scientific», США). В качестве праймера использовали oligo(dT)18, в качестве рибонуклеазного ингибитора в реакционную смесь добавляли RNAsin («Promega», США).  Полученную кДНК амплифицировали с применением праймеров antM2plus (5'- aagctttgatagccacttcaccaatt -3') и antM2minus (5'- ggatccgtttgtttgtgcaaattatg -3'). Дизайн праймеров выполнили с использованием последовательности гена MSH2 культурного томата [HM015771.1] и компьютерной программы Vector NTI Suite 8. Полимеразную цепную реакцию (ПЦР) осуществляли на амплификаторе Терцик MС16 («ДНК-технология», Россия) с использованием смеси полимераз Encyclo и набора реактивов "Encyclo PCR kit" («Евроген», Россия). Температурный профиль ПЦР в ходе 30 циклов: начальная денатурация 94°С - 120 с, денатурация 94°С - 30 с, отжиг праймеров 61°С - 30 с, элонгация 72°С - 100 с. Праймеры для исследований синтезировали в центре коллективного пользования «Биотехнология» при ФГБНУ ВНИИСБ. Продукты амплификации разделяли в 1% агарозном геле и клонировали в векторе pGEM-T согласно инструкции производителя («Promega», США). Секвенирование клонированных фрагментов ДНК (три клона для каждого из трех растений каждого вида томатов) осуществляли с использованием стандартных праймеров Т7 и SP6 («Promega», США). Анализ полученных последовательностей осуществлялся при помощи программ BLAST, BioEdit 7.0 и MEGA 7.0. Моделирование вторичной структуры доменов белка Msh2 осуществляли с помощью сервиса SWISS-MODEL [Waterhouse et al., 2018]. Результаты и обсуждение Известно, что полноразмерная нуклеотидная последовательность кДНК гена MSH2 культурного томата составляет 2832 п.н. [Tam et al., 2009]. При этом в его белке выделили пять основных консервативных доменов, которые включают в себя: N-концевой домен распознающий неспаренные основания (I), средний консервативный домен (II), центральный или основной домен (III), связывающий домен (IV), и консервативный С-концевой домен (V). Ранее при создании конструкции для РНК-интерференции в качестве мишени использовали последовательность кДНК гена MSH2, расположенную между 60 и 440 п.н. относительно инициирующего кодона ATG, нацеленную на I и II домены его белка [Tam et al., 2011]. Однако, поскольку эффективность этой конструкции оказалась низкой, то в данных исследованиях было решено уделить более пристальное внимание области гена, кодирующей II и III домены белка Msh2. Это предположение подкреплялось тем, что III домен содержит консервативную последовательность с ключевым остатком аргинина, мутации в которой нарушают работу белка [Wu and Marinus, 1994].  Рис. 1. Анализ методом максимального правдоподобия нуклеотидных последовательностей участка гена MSH2, кодирующего неполный II, III и неполный IV домены белка Msh2 различных видов томатов и других видов, относящихся к сем. Solanaceae (картофеля клубненосного (Solanum tuberosum L.), перца стручкового (Capsicum annuum L.), трех видов табака (Nicotiana sylvestris Speg and Comes., N. attenuate Torr. ex S. Wats, N. tomentosiformis Goodsp.) и петунии гибридной (Petunia х hybrida hort. ex Vilm.). В качестве внешней группы - последовательность Pyrus x bretschneideri Rehder. Рамками обозначены подгруппы «esculentum» (Esc.), «peruvianum» (Per.) и «hirsutum» (Hirs.) секции Lycopersicon. Fig. 1. Analysis of the nucleotide sequences of the MSH2 gene encoding incomplete II, III and incomplete IV domains of MSH2 protein of different types of tomatoes and other species related to family Solanaceae by the maximum likelihood method. Solanaceae (potato tuber (Solanum tuberosum L.), pepper (Capsicum annuum L.), three species of tobacco (Nicotiana sylvestris Speg and Comes., N. attenuate Torr. ex S. Wats, N. tomentosiformis Goodsp.) and Petunia hybrid (Petunia x hybrid hort. ex Vilm.). As the external group - sequence Pyrus x H. bretschneideri Rehder. The frames indicate the subgroups "esculentum" (Esc.), "peruvian" (Per.) and" hirsutum " (Hirs.) of section Lycopersicon. С использованием последовательности гена MSH2 [HM015771.1] культурного томата разработали праймеры antM2plus и antM2minus, ограничивающие его область между 530 и 1480 п.н. относительно инициирующего кодона ATG. С применением высокоточной полимеразы амплифицировали фрагменты кДНК ожидаемой длины 951 п.н. из генома растений видов S. habrohaites, S. cheesmaniae, S. chilense, S lycopersicum var. cerasiforme, S. corneliomuelleri и S. lycopersicum. В результате секвенирования установили последовательности нуклеотидов, кодирующие II (частично), III и IV (частично) домены белков Mhs2 у пяти дикорастущих видов томатов: S. habrohaites [JN990265.1], S. cheesmaniae [JQ002545.1], S. chilense [JQ002546.1], S. lycopersicum var. cerasiforme [JQ002547.1], S. corneliomuelleri [JQ002548.1], и культурного томата [JQ002549.1], которые аннотировали в базе National Center for Biotechnological Information. При анализе полученных нуклеотидных последовательностей с использованием программы BLAST установили, что они консервативны и на 99% соответствуют части последовательности гена MSH2 [HM015771.1] культурного томата и на 91% последовательности псевдогена Phmsh2 [AY650010.1] петунии гибридной (Petunia x hybrida). Сравнение нуклеотидных последовательностей между собой показало (рис. 1), что они объединяются в группы, в соответствии с тремя систематическими комплексами «esculentum» (красноплодные виды S. cheesmaniae, S lycopersicum var. cerasiforme и S. lycopersicum), «peruvianum» (зеленоплодные виды S. chilense и S. corneliomuelleri) и «hirsutum» (зеленоплодные виды S. habrohaites и S. pennellii), которые предложили выделять на основании кладистического анализа последовательностей ядерной рибосомальной ДНК (5,8 S), RAPD-маркеров и полиморфизма микросателитов [Marshall et al., 2001], а также полных транскриптомов этих видов [Pease et al., 2016]. Единичные нуклеотидные замены, однако, в некоторых случаях оказались значимыми и привели к изменению аминокислотного состава белков Msh2: D291N у S. habrochaites, S. chilense и S. corneliomuelleri; S474F у S. corneliomuelleri; L197V, G232D, D277E, A422V, R426K у S. habrochaites и S466F у всех изученных видов по сравнению с последовательностью Msh2 культурного томата сорта «VFNT Cherry» [HM015771.1] (рис. 2). В результате оказалось, что по аминокислотному составу больше всего отличается от остальных последовательность S. habrochaites. Достаточно сильное отличие этого вида так же согласуется с его систематическим положением по отношению к остальным изучаемым видам [Moyle, 2008]. Анализ вторичной структуры II домена показал, что обнаруженные нами замены аминокислот в этом участке молекулы (L197V, G232D, D277E, D291N у S. habrochaites и D291N у S. chilense и S. corneliomuelleri) не приводят к нарушениям формирования регулярной вторичной структуры. В аминокислотной последовательности III домена так же присутствует консервативная последовательность из 39 а.о. с ключевым остатком аргинина [Tam et al., 2009], изменение которого в белке MutS у кишечной палочки (Escherichia coli) приводит доминированию отрицательного фенотипа [Wu and Marinus, 1994]. Обнаруженные изменения аминокислотного состава не затронули этой консервативной последовательности у всех видов томатов, что свидетельствует о её функциональной значимости. Вторичная структура IV связывающего домена представляет собой две альфа спирали, соединенные β-слоем [Drotschmann et al., 2002]. Замена S466F по расчетным данным не влияет на вторичную структуру IV домена всех изученных аминокислотных последовательностей. Однако, замена S474F, которая обнаружена нами в этом домене у S. corneliomuelleri, возможно, может приводить к его структурным изменениям и влиять на функцию молекулы, что требует дальнейших экспериментальных исследований. В целом, полученные результаты о высокой степени сходства нуклеотидных последовательностей из различных, далеко отстоящих по систематическому положению видов, еще раз указывают на консервативность генов семейства MSH, а в частности на эволюционную стабильность последовательности, кодирующей белок Msh2 у растений.  Представленные результаты позволяют инициировать исследования направленные на создание нокаут-мутантов msh2 томатов или трансгенных растений с пониженной экспрессией гена MSH2. Однако необходимо отметить, что у msh2-мутантов арабидопсиса наряду с увеличением частоты мейотического кроссинговера отметили геномную нестабильность в виде накопления у потомства разнообразных мутаций [Leonard et al., 2003]. Растения арабидопсиса с мутациями генов MLH1 и PMS1 системы MMR также демонстрировали снижение плодовитости и изменение частоты передачи потомству мутантных аллелей [Dion et al., 2007; Li et al., 2009]. Фенотипы растений семейства Solanaceae с мутациями гена MSH2 в настоящее время не известны. Совокупность представленных результатов дает основание предполагать, что создание методом геномного редактирования растений томатов с мутациями всех аллелей гена MSH2 может быть затруднительно или невозможно по причине их пониженной жизнеспособности. Ранее сообщалось, что РНК-интерференция гена MSH2 у культурного томата не в полной мере подавляла его экспрессию в листьях, не влияла на фенотип растений, но и эффект от её использования для индукции мейотического кроссинговера был ограниченным [Tam et al., 2009]. В последней работе причина незначительных эффектов могла заключаться в использование для РНК-интерференции вирусного промотора CaMV35S, эффективность которого в репродуктивных органах растений оставляет желать лучшего [Sunilkumar et al., 2002]. Ранее в наших исследованиях был разработан новый промотор pro-SmAMP2 из растения звездчатка белая (Stellaria media L.), который в трансгенных растениях табака (Nicotiana tabacum L.) был в два раза сильнее, чем вирусный промотор CaMV35S [Маджарова и др., 2018]. Кроме этого, оказалось, что промотор pro-SmAMP2 эффективен для экспрессии рекомбинантных генов в репродуктивных органах растений, поскольку результаты его активности были обнаружены, в том числе в микроспороцитах во время профазы I мейоза [Komakhin et al., 2016].  Рис. 2. Сравнение участка аминокислотных последовательностей, соответствующих неполному II, III и неполному IV доменам белка Msh2. Скобками показаны границы доменов, пунктиром выделена консервативная область домена III. Отличающиеся аминокислотные остатки выделены красным жирным шрифтом. Fig. 2. Comparison of amino acid sequences corresponding to incomplete II, III and incomplete IV domains of MSH2 protein. The boundaries of domains are shown in brackets, the conservative area of domain III is marked with a dotted line. Different amino acid residues are highlighted in red bold. Таким образом, поскольку различия между нуклеотидными последовательностями гена MSH2 из разных видов томатов не существенны, то для РНК-интерференции этих генов у межвидовых гибридов может быть использована конструкция на основе последовательности гена культурного томата. Для ее экспрессии в микроспороцитах томатов целесообразно использовать промотор pro-SmAMP2 из растения S. media.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз