Ассоциации полиморфных ДНК-маркеров с рассеянным склерозом в этнической группе башкир

Авторы:
Насибуллин Т.Р. , Туктарова И.А. , Эрдман В.В. , Тимашева Я.Р. , Заплахова О.В. , Бахтиярова К.З. , Мустафина О.Е.
Название:
Ассоциации полиморфных ДНК-маркеров с рассеянным склерозом в этнической группе башкир
Страницы:
319-326
скачано
7 раз(а)


Рассеянный склероз (РС) рассматривается как аутоиммунное нейродегенеративное многофакторное заболевание, обусловленное сложным взаимодействием множества полиморфных генов и факторов внешней среды. Цель настоящего исследования состояла в анализе ассоциаций РС и полиморфных ДНК-маркеров аутоиммунных заболеваний rs2744148 (LOC107984898), rs744166 (ген STAT3), rs1800693 (ген TNFRSF1A), rs2069762(ген IL2) и rs6897932 (ген IL7R), выявленных в результате проведения полногеномного анализа ассоциаций. Материалом для исследования служили образцы ДНК не родственных между собой больных РС (N=87) в возрасте от 15 до 67 лет и лиц контрольной группы (N=122) в возрасте от 18 до 63 лет. Обе выборки сформированы из этнической группы башкир. В результате анализа ассоциаций изученных полиморфных ДНК маркеров установлено, что для женщин генотип IL2*G/G связан с пониженным риском РС (P=0.02, OR= 0.28 95% CI 0.1 - 0.81). Кроме того, с помощью алгоритма APSampler были выявлены сочетания аллелей, ассоциированные с повышенным риском развития РС с учётом гендерной принадлежности, в составе которых наиболее часто встречались аллели rs2744148*G, STAT3*T, TNFRSF1A*G, IL2*T, IL7R*T.
Введение
Рассеянный склероз (РС) - аутоиммунное нейродегенеративное заболевание, сопровождающееся стойкой утратой трудоспособности в молодом возрасте. При этом наблюдается постепенный рост заболеваемости, как в странах Европы, так и в отдельных регионах России, в том числе в Республике Башкортостане [Пажигова и др. (Pazhigova et al.), 2014; Иванова и др. (Ivanova et al.), 2017]. Согласно современным представлениям, РС рассматривается как многофакторное полигенное заболевание, развитие которого обусловлено множеством сложно взаимодействующих факторов. Одним из направлений исследования наследственной природы РС является анализ ассоциаций полиморфных ДНК-маркеров с заболеванием. При этом применяется как анализ отдельных полиморфных маркеров, расположенных в областях генов, контролирующих синтез белков, задействованных в патогенезе заболевания (ген-кандидатный подход), так и широкомасштабный скрининг анонимных маркеров, расположенных по всему геному (GWAS - Genome Wide Association Studies). Второй подход, помимо выявления маркеров риска, даёт возможность выявить новые, ранее не известные области генома, ассоциированные с заболеванием, и проводить в этих областях поиск генов, вовлеченных в патогенез РС. Важным этапом полногеномных исследований является репликация полученных результатов на независимых выборках с целью подтверждения полученные результаты.
Следует отметить, что значительная часть данных, полученных в результате полногеномных исследований, а также и работ, в которых использовался ген-кандидатный подход, не находит подтверждения при анализе на выборках из других популяций. Данное обстоятельство объясняется как гетерогенностью популяций, так и относительно небольшим влиянием выявленных полиморфных маркеров на развитие заболевания, которое может быть нивелировано влиянием других факторов. Поэтому представляется важным поиск составных маркеров, которые могут обладать лучшей информативностью для большего количества популяций.
Исходя из вышеизложенного, цель настоящего исследования состояла в проверке результатов полногеномных исследований РС для полиморфных маркеров rs2744148 (LOC107984898), rs744166 (ген STAT3), rs1800693 (ген TNFRSF1A), rs2069762(ген IL2) и rs6897932 (ген IL7R) и анализе вклада сочетаний данных полиморфных маркеров в формирование предрасположенности к РС.
Материалы и методы
Материалом для исследования служили образцы ДНК неродственных между собой больных РС (87 человек: 58 женщин, 29 мужчин) в возрасте от 15 до 67 лет (средний возраст 38.08±11.12 лет). Все пациенты прошли полное клиническое обследование на базе Республиканской клинической больницы им. Куватова (Уфа), диагноз РС устанавливался согласно критериям [McDonald et al., 2001]. Средняя длительность заболевания составила 11.6±8.33 лет, при среднем возрасте манифестации заболевания 32.83±9.07 лет. В контрольную группу вошли 122 человек (52 мужчин, 70 женщин) в возрасте от 18 до 63 лет (средний возраст 40.67±10.51 лет). Все участники исследования были башкирами по этнической принадлежности, постоянно проживающими в Республике Башкортостан. У всех лиц, включенных в исследование, было получено письменное добровольное информированное согласие на участие в нём.
Образцы ДНК выделялись из лейкоцитов периферической крови методом фенольно-хлороформной экстракции. Генотипирование полиморфных маркеров осуществляли с помощью сайт-специфичной ПЦР. Для каждого образца ДНК ставились две ПЦР-реакции, в каждой из которых содержался один из аллель-специфичных праймеров и пара праймеров, обеспечивающих синтез фрагмента с исследуемой заменой, которой служил в качестве контроля проведения реакции. Подбор праймеров и рестриктаз для каждого маркера осуществлялся с помощью пакета программ DNAStar 7.1.0 и баз данных http://www.ncbi.nlm.nih.gov/snp. Перечень анализируемых полиморфных ДНК-маркеров, их локализация, последовательности праймеров и размеры амплифицированных фрагментов представлены в Таблице 1. Разделение полученных ампликонов проводили с помощью электрофореза в 2% агарозном геле.
Таблица 1.
Перечень анализируемых полиморфных ДНК-маркеров их локализация,
последовательности праймеров и размеры амплифицированных фрагментов
Table 1. List of analyzed polymorphic DNA markers, their localization, primer sequences and amplified fragment sizes
Ген, хромосомная локализация
Gene, Chromosome localization
Полиморфизм
генная локализация
Polymorphism
Gene localization
Праймеры (5'-3')
Primers (5'-3')
F - forward; R - reverse
A; C; G; T - allel-specific nucleotides
Размеры амплифицированных
фрагментов
Amplified fragment sizes
LOC107984898. SSTR5-AS1
16p13.3
rs2744148
F gcttttgctctgaggtctgc
R tggagatttctgaccacccca
G ctgccaggcacgttcttcg
A ctgccaggcacgttcttca
ВК 238
Аллель 175
STAT3
17q21.2
rs744166
1 интрон
F cttttcctgaggggatggca
R ttcagatggcggtcacatgc
C tgtcttgagggaatcgatcc
T tgtcttgagggaatcgatct
ВК 253
Аллель 135
TNFRSF1A
12p13.2
rs1800693
6 интрон
F atggtagggcctctgttcac
R gcagacaaagcaggtgttgg
G gaggactcaggtgaggactg
A gaggactcaggtgaggacta
ВК 254
Аллель 149
IL2
4q27
rs2069762
промотор
F tgaaacaggaaaccaatacact
R cccacacttaggtgatagctc
G cacatgttcagtgtagtttttg
T cacatgttcagtgtagtttttt
ВК 239
Аллель 140
IL7RA
5p13.2
rs6897932
6 экзон
F agctgtcaaatatgtctctta
R cacacaatcaccctctttat
C atggatcctatcttactaac
T atggatcctatcttactaat
ВК 278
Аллель 126
ВК - внутренний контроль (пояснения в тексте)
ВК - internal control (description in text)
Для сравнения групп по распределению частот генотипов и аллелей использовался точный двухсторонний тест Фишера. Для проверки отклонения наблюдаемых частот генотипов от теоретически ожидаемого равновесного распределения Харди-Вайнберга применялся точный тест, реализованный в программе Arlequin 3.0. Поиск сочетаний аллелей/генотипов, ассоциированных с РС, осуществлялся с помощью программы APSampler 3.6.1. Программа и её описание представлены на сайте http://sourceforge.net/projects/apsampler/, основной алгоритм описан в статье А.В.Фаворова и соавт. [Favorov et al., 2005]. Для сравнения частот встречаемости сочетаний аллелей в группе пациентов с РС и контрольной группе в качестве поправки на множественность сравнений использовался пермутационный тест. Статистически значимыми различия считали при Pperm меньше 0.05.
Результаты исследований
Результаты анализа распределений частот генотипов по исследованным полиморфным ДНК маркерам в контрольной группе и группе больных РС представлены в Таблице 2. В контрольной группе полученные распределения частот генотипов по всем маркерам соответствовали теоретически ожидаемым согласно закону Харди-Вайнберга. Сравнительный анализ частот генотипов в контрольной группе и группе больных РС не выявил статистически значимых результатов по всем пяти маркерам.
Таблица 2.
Результаты анализа ассоциаций полиморфных ДНК-маркеров с рассеянным склерозом
Table 2. Results of the analysis of associations of polymorphic DNA markers with multiple sclerosis
Генотип
Genotype
Контроль / Control
Больные / Patients
Р
n
Частота
Frequency
% (95%CI)
*A/A
95
77.24 (68.81 - 84.31)
60
68.97 (58.14 - 78.45)
0.204
*A/G
26
21.14 (14.3 - 29.42)
22
25.29 (16.58 - 35.75)
0.508
*G/G
2
1.63 (0.2 - 5.75)
5
5.75 (1.89 - 12.9)
0.129
rs744166 (ген / gene STAT3)
*T/T
49
38.89 (30.34 - 47.98)
30
34.48 (24.61 - 45.44)
0.565
*T/C
61
48.41 (39.42 - 57.48)
44
50.57 (39.64 - 61.47)
0.782
*C/C
16
12.7 (7.44 - 19.8)
13
14.94 (8.2 - 24.2)
0.687
rs1800693 (ген / gene TNFRSF1A)
25
20.33 (13.61 - 28.52)
24
27.59 (18.54 - 38.21)
0.248
*G/A
58
47.15 (38.09 - 56.36)
37
42.53 (31.99 - 53.59)
0.574
40
32.52 (24.35 - 41.55)
29.89 (20.54 - 40.65)
0.763
rs2069762 (ген / gene IL2)
29.84 (21.96 - 38.71)
28
32.56 (22.84 - 43.52)
0.762
*T/G
64
51.61 (42.47 - 60.68)
50
58.14 (47.01 - 68.7)
0.399
23
18.55 (12.14 - 26.52)
8
9.3 (4.1 - 17.51)
0.076
rs6897932 (ген / gene IL7R)
77
62.6 (53.42 - 71.16)
48
56.47 (45.28 - 67.2)
0.391
*C/T
35.29 (25.23 - 46.41)
0.766
6
4.88 (1.81 - 10.32)
7
8.24 (3.38 - 16.23)
0.388
Примечание: CI - доверительный интервал. P - значение точного двухстороннего теста Фишера
Note: CI is the confidence interval. P - value of exact two-sided Fisher's test
Поскольку в аутоиммунных заболеваниях существенную роль играет пол больных, нами проведён анализ распределений частот генотипов с учётом пола участников исследования (Таблица 3). Из представленных материалов следует, что у женщин в группе больных в отличие от соответствующей контрольной группы снижена доля гомозигот по аллелю *G (P=0.02, OR= 0.28 95% CI 0.1 - 0.81). Других статистически значимых результатов получено не было. В тоже время, в подгруппах мужчин и женщин с помощью алгоритма APSampler нами проведён поиск составных маркеров, ассоциированных с РС, в результате которого было выявлено одно сочетание, связанное с пониженным риском РС, и четыре составных маркера, ассоциированных с повышенным риском РС (Таблица 4).
Таблица 3
Результаты анализа ассоциаций полиморфных ДНК-маркеров с риском рассеянного склероза с учётом пола
Table 3. Results of the analysis of associations of polymorphic DNA markers with the risk of multiple sclerosis, taking into account gender
Мужчины ./ Males
Женщины / Females
Frequency
1
3
4
9
10
11
rs2744148
76.92 (63.16 - 87.47)
79.31 (60.28 - 92.01)
54
77.14 (65.55 - 86.33)
63.79 (50.12 - 76.01)
0.118
12
23.08 (12.53 - 36.84)
13.79 (3.89 - 31.66)
0.392
14
20 (11.39 - 31.27)
18
31.03 (19.54 - 44.54)
0.159
0
-
6.9 (0.85 - 22.77)
0.125
2.86 (0.35 - 9.94)
5.17 (1.08 - 14.38)
0.658
42.31 (28.73 - 56.8)
41.38 (23.52 - 61.06)
27
36.99 (25.97 - 49.09)
0.579
46.15 (32.23 - 60.53)
48.28 (29.45 - 67.47)
36
49.32 (37.4 - 61.28)
51.72 (38.22 - 65.05)
0.861
11.54 (4.35 - 23.44)
10.34 (2.19 - 27.35)
13.7 (6.77 - 23.75)
17.24 (8.59 - 29.43)
0.63
21.15 (11.06 - 34.7)
24.14 (10.3 - 43.54)
0.785
17
29.31 (18.09 - 42.73)
0.3
19
36.54 (23.62 - 51.04)
15
51.72 (32.53 - 70.55)
0.241
39
55.71 (43.34 - 67.59)
37.93 (25.51 - 51.63)
0.052
0.147
24.29 (14.83 - 36.01)
32.76 (21.01 - 46.34)
0.327
rs2069762(ген / gene IL2)
27.59 (12.73 - 47.24)
0.469
25.35 (15.77 - 37.08)
20
35.09 (22.91 - 48.87)
0.249
53.85 (39.47 - 67.77)
62.07 (42.26 - 79.31)
0.494
35
49.3 (37.22 - 61.44)
32
56.14 (42.36 - 69.26)
0.48
9.62 (3.2 - 21.03)
8.77 (2.91 - 19.3)
0.02
31
59.62 (45.1 - 72.99)
67.86 (47.65 - 84.12)
0.629
46
65.71 (53.4 - 76.65)
29
50.88 (37.29 - 64.37)
0.105
32.69 (20.33 - 47.11)
28.57 (13.22 - 48.67)
0.803
31.43 (20.85 - 43.63)
38.6 (26 - 52.43)
0.455
7.69 (2.14 - 18.54)
3.57 (0.09 - 18.35)
0.653
10.53 (3.96 - 21.52)
0.138
Таблица 4.
Результаты анализа ассоциаций рассеянного склероза и сочетаний изученных полиморфных маркеров
Table 4. Results of the analysis of associations of multiple sclerosis and combinations of the studied polymorphic markers
Сочетание / Combination
Контроль / Control, %
РС, %
P (Pperm)
OR
95%CI
TNFRSF1A*G/A+IL7R*C/C
42.03
10.53
5.95х10-5 (2.98х10-4)
0.16
(0.06-0.43)
rs2744148*G+IL2*T+IL7R*T
1.43
19.30
6.34х10-4 (2.54х10-3)
16.5
(2.06-132.19)
rs2744148*G+STAT3*T+IL7R*T
2.86
15.79
0.011 (0.044)
12.94
(1.58-105.5)
22.81
0.011 (0.034)
6.37
(1.32-30.83)
rs2744148*G+ TNFRSF1A*G+ IL7R*T
2.9
0.012 (0.047)
6.28
(1.29-30.39)
Мужчины / Males
STAT3*T/C+TNFRSF1A*G/A
10.42
31.03
0.016 (0.042)
4.32
(1.29-14.51)
Обсуждение
Основной целью настоящего исследования являлся репликационный анализ результатов полногеномных исследований РС. Следует отметить, что, если анализ отдельных полиморфных маркеров, за исключением результата для генотипа IL2*G/G у женщин, не выявил значимых результатов, то поиск составных маркеров, ассоциированных с риском РС, такие результаты дал, что свидетельствует о большей эффективности применения алгоритма APSampler по сравнению с простым однолокусным анализом. Так же можно отметить, что в составе полученных сочетаний присутствуют аллельные варианты всех полиморфных маркеров, вошедших в исследование.
Аллели rs2744148*G и IL7R*T наиболее часто встречаются в составе сочетаний ассоциированных с повышенным риском РС. Согласно работе [Sawcer et al., 2011], выполненной на выборке европейцев, rs2744148*G ассоциирован с повышенным риском РС, что согласуется с полученными нами результатами. Кроме того, этот результат был подтверждён в более поздней работе [Disanto et al., 2012]. В тоже время, для аллеля IL7R*T, который в нашей работе был ассоциирован с повышенным риском РС, другими исследователями получены противоречивые результаты. Так, по данным нескольких GWAS, аллель IL7R*C полиморфного маркера rs6897932 ассоциирован с повышенным риском РС [Sawcer et al., 2011; International Multiple Sclerosis Genetics Consortium, 2007]. Схожие результаты были получены и в других исследованиях [Lundmark et al., 2007; Ali-Reza et al., 2017]. В работе [Al-Mossawi et al., 2018] продемонстрировано, что у носителей генотипа IL7R*C/C в сравнении с лицами, у которых выявлен аллель IL7R*T, в моноцитах, стимулированных липополисахаридом, обнаруживаются более высокие показатели экспрессии гена IL7R.
    Согласно результатам GWAS, выполненных на выборке жителей Финляндии, аллель STAT3 rs744166 *C связан с повышенным риском РС [Jakkula et al., 2010]. Эти результаты были подтверждены в исследовании, проведённом среди жителей Германии [Lill et al., 2012]. В тоже время изучение другой аутоиммунной патологии - болезни Крона - продемонстрировало связь аллеля STAT3 *T с повышенным риском этого заболевания [Barrett et al., 2008]. Этот результат подтверждён данными мета-анализа 11 работ (всего 10298 больных и 11191 контроль) [Hofjan et al., 2015]. В нашем исследовании аллель STAT3*T встречается в составе сочетаний, ассоциированных с повышенным риском РС, что отчасти коррелирует с результатами, полученными при поиске генетических маркеров болезни Крона, но противоречит данным исследований по РС.
    В составе выявленных нами сочетаний, связанных с повышенным риском РС, также входят аллели TNFRSF1A rs1800693*G и IL2 rs2069762*T, которые выявлены в качестве маркеров риска в других исследованиях. Так, связь аллеля TNFRSF1A*G с РС обнаружена в GWAS, выполненном на выборке жителей Европы [Sawcer et al., 2011], и подтверждена в более поздних работах [Hoffjan et al., 2015; Javor et al., 2018]. Продемонстрирована связь аллеля IL2*T с повышенным риском РС [Sayad et al., 2011], кроме того в этой же работе показано, что у носителей генотипа IL2*T/Т обнаруживаются более высокие уровни IL2 в плазме по сравнению с носителями аллеля IL2*G, что соответствует полученным нами результатам.
В заключение следует отметить, что приведенные данные свидетельствуют о существенном вкладе изученных полиморфных маркеров в формирование предрасположенности к РС. Выявленные нами маркеры могут служить основой для дальнейшего поиска информативных предикторов РС и разработке мер по первичной и вторичной профилактике данного заболевания.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз