Анализ экспрессии генов, связанных с метилированием ДНК у партеногенетической кукурузы

Авторы:
Волохина И.В. , Моисеева Е.М. , Гуторова О.В. , Гусев Ю.С. , Чумаков М.И.
Название:
Анализ экспрессии генов, связанных с метилированием ДНК у партеногенетической кукурузы
Страницы:
187-192
скачано
14 раз(а)


Приведены экспериментальные данные об экспрессии генов, связанных с метилированием ДНК (dmt102, dmt103, dmt105, hdt104, hon101, chr106), в завязях, зародышевых мешках при экспериментальной задержке опыления на 3, 7 дней и в проэмбрио, зародышах и эндосперме партеногенетической (АТ-3) и контрольной (ГПЛ-1) линий кукурузы через 3, 7 дней после опыления. У кукурузы линий АТ-3 и ГПЛ-1 обнаружено отличие в экспрессии гена dmt102 в завязях и зародышевых мешках при искусственной задержке опыления и гена hdt104 в зародышевых мешках и эндосперме после опыления. Через семь дней после опыления в зародышах обеих линий экспрессия всех исследованных (кроме chr106) генов была подавлена. А в эндосперме партеногенетической линии АТ-3 спустя семь дней после опыления зарегистрирована экспрессия четырех (dmt103, hdt104, hon101, chr106) из шести исследованных генов.
Введение
Покрытосеменные растения размножаются половым и бесполым (апомиктичным) путями. Хотя половое размножение является доминирующим у покрытосеменных, оно не является единственным способом размножения, и бесполое существует у многих видов растений. Апомиктичные растения «обходят» мейоз и оплодотворение яйцеклетки, развивая партеногенетические зародыши, являющиеся генетическими клонами материнского растения [Grimanelli, 2012]. Хотя апомиксис контролируется генетически, многие локусы, способствующие его проявлению, до сих пор не определены. Считается, что у современных сортов и линий кукурузы апомиксис отсутствует, однако саратовскими селекционерами была получена линия кукурузы АТ-1 и ее производные (линии АТ-3, АТТМ), у которых автономный (без опыления) эмбрио- и эндоспермогенез (матроклинный партеногенез или гиногенез) наблюдались с повышенной (6-50% и более) частотой [Тырнов, Еналеева (Tyrnov, Enaleeva), 1983; Enaleeva, Tyrnov, 1997; Гуторова и др. (Gutorova et al.), 2016]. Линия AТ-1 выделена в самоопыленном потомстве гибрида, полученного после скрещивания линии Stock 6 [Сое, 1959] и линии Коричневый маркер (КМ), имеет антоциановую окраску [Тырнов, Еналиева (Tyrnov, Enaleeva), 2003]. Для линии АТ-1 характерен наследуемый тип партеногенеза, этот признак является ядерным и передается через пыльцу и яйцеклетку из поколения в поколение. Линия АТ-3 была получена скрещиванием линии АТ-1 и линии ГПЛ, имеет зеленую окраску [Тырнов, Еналеева (Tyrnov, Enaleeva), 1983; Enaleeva, Tyrnov, 1997]. В потомстве линии АТ-3 были отобраны растения, склонные к наследуемому партеногенезу, однако природа этого явления и генетический контроль не ясны до настоящего времени.
Ряд авторов считает, что апомиксис может возникнуть в результате изменения регуляции транскрипционных программ, которые контролируют половое размножение у растений и осуществляются с использованием эпигенетической регуляции [Grimanelli et al., 2003; Koltunow, Grossniklaus, 2003; Bicknell, Koltunow, 2004; Bradley et al., 2007; Grimanelli, 2012; García-Aguilar, Gillmor, 2015]. Так, при сравнении экспрессии генов, связанных с метилированием ДНК (dmt102, dmt103, dmt105, hdt104, chr106, hon101) у кукурузы и апомиктичного гибрида кукурузы и трипсакума (С38) было выявлено, что у гибрида экспрессия четырех (dmt102, dmt103, dmt105, chr106) из шести выше указанных генов была подавлена на трех стадиях развития (спорогенез, зрелый зародышевый мешок до оплодотворения, ранний эмбриогенез (три дня после оплодотворения)), а еще два гена (hon101, hdt104) имели гетерохронную экспрессию [Garcia-Aguilar et al., 2010].
В связи с вышеописанным, целью данной работы был анализ экспрессии генов, связанных с метилированием ДНК в завязях, зародышевых мешках, эндосперме, проэмбрио и зародыше партеногенетической кукурузы линии АТ-3 при экспериментальной задержке опыления и после оплодотворения.

Материалы и методы
Выделение РНК из растительных образцов.
Опытные растения кукурузы партеногенетической линии АТ-3 (производная от линии АТ-1 [Тырнов, Еналеева (Tyrnov, Enaleeva), 1983] выращивали на полях ФГБНУ РосНИИСК «Россорго» (Саратов). В качестве контроля для линии АТ-3 использовали линию ГПЛ-1 (дигаплоидизированный гаплоид), не обладающую способностью к матроклинному партеногенезу (гиногенезу). В период цветения (конец июля - начало августа) початки до появления рылец помещали под пергаментные изоляторы для предотвращения опыления. Выделение мРНК проводили из завязей, зародышевых мешков, зародышей и эндосперма, извлеченных из предварительно замороженных при – 20ºС початков партеногенетической (АТ-3) и контрольной линий кукурузы, как было ранее описано [Волохина и др. (Volokhina et al.), 2017; Moiseeva et al., 2017]. Образцы препаратов извлекали препаровальными иглами под стереоскопическим микроскопом МБС-9 (Россия) в капле охлажденного глицерина на охлажденном предметном стекле и сразу помещали в пробирку эппендорф (на льду) c экстракционным буферным раствором (50 мМ Tris-HCl, 300 мМ NaCl, 5 мМ EDTA, 2% SDS, 10 мМ ß-меркаптоэтанол).
Анализ экспрессии генов метилирования ДНК у кукурузы.
С мРНК получали кДНК с олиго-Т праймерами (Синтол, Россия) согласно инструкции производителя ревертазы (Fermentas, Литва) и проводили ОТ-ПЦР анализ экспрессии генов с использованием специфических праймеров на приборе Mastercycler personal (Еppendorf, Германия).
Таблица
Амплифицируемые с помощью ПЦР фрагменты ряда генов
Table. Fragments of several genes amplified by PCR
Гены
Genes Праймеры / Primers (5’→3’) ПЦР-продукт (п.н.)
PCR-product (bp)
Прямой / Forward Обратный / Reverse
dmt102 CCGTTGGTTCTTCCGAGCAG GGTATCACTGTCTGACTGCC 292
dmt103 TGAAGACGAGGCTGCACTGGC ACTTCCCTGTGCTTGGCCTCCA 202
dmt105 TACTTGCCGTTGGTTTTTCC GCTTTCTCATTTCGCACCTC 535
chr106 GAGCGGATCATCAAGAAAGC TGGATCATCCGATCTTCCTC 161
hdt104 GTAGTTGGCAAGAAGAGGGC ACTGCCGAAAGATTTGCTGC 225
hon101 CTTCGAGATGATCAAGGAGG CGAAGCCTTGACCTTCACGA 184
Праймеры (табл.) подбирали с помощью ресурса Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/ primer3plus.cgi). Условия проведения ПЦР для генов dmt102, dmt103, dmt105: денатурация 95 °С – 3 мин; затем 35 циклов по 95 °С – 30 сек, 60 °С – 30 сек, 72 °С–1 мин. Для генов chr106, hdt104, hon101: денатурация 95 °С – 3 мин; а затем 35 циклов по 95 °С – 30 сек, 58 °С –30 сек, 72 °С – 30 сек. В качестве внутреннего контроля использовали мРНК гена актина (act1) (прямой 5’-CCTGAAGATCACCCTGTGCT-3’, обратный 5’- GCAGTCTCCAGCTCCTGTTC-3’) 95 °С – 30 сек, 63 °С – 1 мин, 72 °С–1 мин. ПЦР-продукт с кДНК фрагмента гена act1– 398 п.н. Результаты ПЦР визуализировали с помощью гель-электрофореза в 1,5% агарозном геле. Экспрессией гена считали варианты, где наблюдали полосу с ПЦР-продуктом, с соответствующей молекулярной массой; подавлением экспрессии гена считали варианты, где полосу с ПЦР-продуктом, с соответствующей молекулярной массой не наблюдали (рис. 1, 2).
Результаты и обсуждение
Установлено, что при экспериментальной задержке опыления на 3 дня (3 дня после появления пестичных рылец, 3ДППР) в тканях завязей кукурузы экспрессируются все исследованные гены, за исключением гена, кодирующего хромметилтрансферазу (dmt102) у линии АТ-3 (рис. 1).
Рис. 1. Анализ экспрессии генов, связанных с метилированием ДНК кукурузы, в тканях
женского гаметофита при искусственной задержке опыления на 3, 7 ДППР.
Примечание: Первые сутки задержки опыления определяли со дня появления пестичных рылец (ДППР)
на початках. Данные получены по 3-7 независимым экспериментам. В каждом эксперименте
для анализа использовали 5 завязей и зародышевых мешков (ЗМ).
Fig. 1. Maize DNA methylation genes expression in female gametophite tissues during 3 and 7 days
of the appearance of the pestle stigmas (DAPS).
Note: * - the first day of the delay of pollination was determined from the day of the appearance of the
pestle stigmas (DAPS) on the cob. The data were obtained for 3-7 independent experiments.
In each experiment were used for the analysis 5 pieces of ovaries and embryo sacs.
Через 7ДППР в тканях завязей контрольной линии кукурузы наблюдалась экспрессия всех генов, за исключением гена dmt102 (рис. 1). В те же сроки искусственной задержки опыления (3,7 ДППР) в зародышевом мешке (ЗМ) экспрессия генов dmt102, dmt105, hdt104 у АТ-3 и контрольной линий подавлена, поскольку мы не наблюдали соответствующих ПРЦ-продуктов с кДНК (рис. 1). Т.е., картина экспрессии генов, кодирующих хромметилтрансферазы (dmt102, dmt105) и гистоновую деацетилазу (hdt104), в завязях и в зародышевых мешках может отличаться. В связи с этим, проведение анализа экспрессии этих генов только в завязях или семяпочках, как в работе [Garcia-Agular et al., 2010], недостаточно, необходим анализ экспрессии генов в ЗМ, хотя операция по извлечению ЗМ очень трудоемка. Различия в экспрессии исследованных нами генов, связанных с метилированием ДНК, в ЗМ партеногенетической (АТ-3) и контрольной линиях к 7ДППР проявляются только по гену hdt104, экспрессия которого у АТ-3 подавлена, поскольку мы не наблюдали соответствующего ПРЦ-продукта (рис. 1). Интересно отметить, что у трех (dmt103 (метилтрансфераза), chr106 (хроматин-модулирующий фактор), hon101 (гистоновый линкер)) из шести исследованных генов наблюдается экспрессия и в завязях, и в ЗМ как через 3ДППР, так и через 7ДППР (рис. 1).
Рис. 2. Анализ экспрессии генов, связанных с метилированием ДНК кукурузы в тканях
женского гаметофита через 3 и 7 дней
после опыления (3,7 ДПО).
Примечание: данные получены по 3-7 независимым экспериментам. В каждом эксперименте для
анализа использовали по 5 образцов
зародышей и 7 шт. эндосперма.
Fig. 2. Maize DNA methylation genes expression
in female gametophite tissues during 3 and 7 days
after pollination (DAP).
Note: The data were obtained for 3 and 7 independent experiments. In each experiment, 5, 7 samples were
used for the embryos and endosperm analysis.
В ЗМ спустя три дня после опыления (3ДПО) у партеногенетической линии AT-3 синтез метилтрансфераз, кодируемых генами dmt102, dmt103, dmt105, подавлен, а у контрольной линии в дополнение к указанным трем генам не обнаружена экспрессия гистоновой диацетилазы, кодируемой геном hdt104. Через 7ДПО в зародышах обоих линий экспрессия всех генов, связанных с метилированием ДНК (кроме chr106) подавлена (рис. 2).
В это же время в эндосперме партеногенетической (АТ-3) линии через 7ДПО зарегистрирована экспрессия всех исследованных генов (кроме dmt102, dmt105, рис. 2). В эндосперме контрольной линии через 7ДПО наблюдается экспрессия генов dmt103, chr106, hon101, поскольку были обнаружены соответствующие ПЦР-продукты с кДНК (рис. 2). Различие между исследованными линиями зарегистрировано в завязях: у контрольной линии через 3ДППР наблюдается экспрессия гена dmt102, в то время как у линии АТ-3 его экспрессия подавлена (рис. 2). Обусловлено ли это различие партеногенетически развивающимся проэмбрио предстоит выяснить. Во всех исследованных ЗМ картина экспрессии генов, связанных с метилированием ДНК, у исследованных линий при задержке опыления на 3 и 7 дней выглядит одинаково (рис. 2). После опыления (7ДПО) наблюдается различие в экспрессии гена hdt104, кодирующего гистоновую деацетилазу: в эндосперме линии АТ-3 наблюдается экспрессия hdt104, в то время как у контрольной линии этот ген репрессирован (рис. 2).
Заключение
Таким образом, установлено, что в экспрессии исследованных генов, связанных с метилированием ДНК (dmt102, dmt103, dmt105, hdt104, chr106, hon101), наблюдаются отличия у партеногенетической линии АТ-3 и контрольной линий в зародышевых мешках до опыления (ген dmt102), и в зародышах через 7 дней после опыления (ген hdt104). Спустя 3 и 7 дней после опыления в зародышах у исследованных партеногенетической (АТ-3) и контрольных линий кукурузы экспрессия всех генов, связанных с метилированием ДНК (кроме chr106), подавляется. Спустя семь дней после опыления разница между партеногенетической (АТ-3) и контрольной линиями наблюдается в экспрессии гена hdt104 в эндосперме – у линии АТ-3 наблюдается экспрессия гена hdt104, в то время как в эндосперме контрольной линии ген hdt104 репрессирован.
Благодарности
Статья посвящена памяти В.С. Тырнова, начавшего работы по апомиксису кукурузы более 40 лет назад и стимулировавшему наш интерес к данной тематике и к линии кукурузы АТ-3, полученной в его лаборатории. Авторы признательны Ю.В. Смолькиной за предоставленную возможность работать с линиями АТ-3 и ГПЛ-1. И.Б. Иванову мы благодарим за помощь в получении образцов завязей кукурузы.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз