Метилирование ДНК у комнатной мухи Musca domestica L.

Авторы:
Никоноров Ю.М. , Ахметкиреева Т.Т. , Беньковская Г.В.
Название:
Метилирование ДНК у комнатной мухи Musca domestica L.
Страницы:
266-274
скачано
20 раз(а)


Метилирование ДНК играет существенную роль в регуляции генной активности у животных и растений. Однако у представителей ряда таксонов насекомых (Diptera, в том числе) системы метилирования ДНК в той или иной мере редуцированы, и они могут представлять интерес в качестве модельных объектов для исследования явления фенотипической пластичности, реализуемой через различные эпигенетические механизмы. С помощью метода метилчувствительной ПЦР мы провели определение наличия 5-метилцитозина в ДНК комнатной мухи на стадии личинки III возраста, пупария (куколки) и 2-х и 3-х недельных имаго. Размах индивидуальных различий между особями по относительной устойчивости ДНК к расщеплению рестрикционной эндонуклеазой HpaII по некоторым локусам составил от 0.01 до 4.21%.
Введение В процессе развития многоклеточного организма различные клетки и ткани реализуют разные программы генной активности, которые постоянно корректируются посредством эпигенетических механизмов [Jablonka and Lamb, 1998]. Модификации гистоновых белков, метилирование азотистых оснований в ДНК, активность малых некодирующих РНК - это наиболее полно исследованные механизмы, с помощью которых сохраняется и передается эпигенетическая информация [Roberts and Gavery, 2012]. Энзиматическому метилированию ДНК принадлежит ключевая роль в ряде эпигенетических процессов - тканевой и клеточной дифференцировке, морфогенезе, геномном импринтинге и эпигенетическом репрограммировании, которые реализуются, в общем случае, посредством формирования и поддержания определенной структуры хроматина, чувствительного к содержанию модифицированных оснований в ДНК [Morgan et al., 2005]. Такая структура, благодаря энзиматическому маркированию ДНК, сохраняется в ряду поколений делящихся клеток в соматических тканях в течение всего онтогенеза и, предположительно, в некоторых случаях, может воспроизводиться у потомства в результате специфического репрограммирования герминальных клеток в процессе различных адаптаций [Angers et al., 2009].  Установлено, что метилирование ДНК может вносить существенный вклад в вариации развития фенотипа и у насекомых. Для медоносной пчелы Apis mellifera показано наличие глобального эпигенетического репрограммирования экспрессии генов на стадии личинки в зависимости от пищевых сигналов, результатом которого является генерация двух «каст» самок, рабочих особей и «королев», изначально имеющих идентичные геномы [Barchuk et al., 2007; Maleszka, 2008]. В то же время существует несколько таксономических групп насекомых, у которых системы метилирования ДНК сильно редуцированы, и их проявление ограничивается эмбриональной стадией или же связано с регуляцией активности отдельных фракций генома [Glastad et al., 2011]. В геноме Drosophila melanogaster выявлены оба обязательных компонента ДНК-метилирующей системы - и ДНК-метилтрансферазы, и связывающие метилированную ДНK белки [Hung et al., 1999; Tweedie et al., 1999]. Однако метилирование ДНК происходит преимущественно в динуклеотидах СТ/СА, а не CG (или CNG), как у высших животных и растений. Наивысшее содержание 5-метилцитозина (5mC) в ДНК наблюдается у 1-2-х час эмбрионов (0,4%), у 15-16 час эмбрионов его содержание падает до 0,1%, в тканях имаго и отложенных яйцах содержание еще ниже при отсутствии заметной ДНК-метилтрансферазной активности [Lyco et al., 2000]. У взрослых особей наличие метилированного цитозина в ДНК детектируется на протяжении всей жизни в соотношении к неметилированному примерно 1 на 1000-2000 [Gowher et al., 2000]. Распределение 5mC в ДНК взрослых мух, тем не менее, носит не случайный характер и локализуется преимущественно в: а) повторяющихся последовательностях генома и транспозонах (5 и 4, соответственно, из 27 последовательностей, где 5mC выявляется в реакции с соответствующими антителами; б) кодирующих областях генов, экспрессирующихся на ранних стадиях онтогенеза: из 9 генов с известными функциями только два экспрессировались у имаго [Salzberg et al., 2004]. Таким образом, есть основания предполагать участие процесса метилирования цитозина в ДНК у дрозофилы в регуляции активности транспозонов и онтогенетической регуляции генов, активность которых необходима только во время эмбриогенеза и при метаморфозе [Mandrioli, Borsatti, 2006]. Функциональная ограниченность использования 5mC в геноме дрозофилы выводит на первый план другие эпигенетические механизмы. Так, маркером фунционально активного эухроматина является триметилирование лизина в положение 4 гистона H3 [Eissenberg, Shilatiard, 2010], а инертный гетерохроматин маркируется  преимущественно метилированием лизина в положении 9 [Koryakov et al., 2011]. Обнаруженный в составе ДНК дрозофилы N6-метиладенин (6mA) в количестве 0.001-0.07% ассоциирован, в основном, с транспозонами [Zhang et al., 2015]. В любом случае, довольно длительный период, когда дрозофила представлялась некоторым исключением из общего правила ввиду «отсутствия» 5mC в составе ее ДНК, завершен, а процессы метилирования ДНК у этого вида заняли свое, хотя и скромное в данном случае, место в эпигенетической регуляции генной активности.  Комнатная муха Musca domestica с ее быстрым и синхронным развитием и сравнительно короткой продолжительностью жизни является удобным объектом исследований ответных реакций организма на изменение различных факторов внешней среды. Взрослые особи комнатной мухи являются механическими переносчиками свыше 100 опасных инфекционных заболеваний, а некоторые патогенные виды даже часть своего жизненного цикла проводят в организме комнатной мухи [Greenberg, 1965]. Высокая социальная значимость объекта определила привлечение к нему надлежащего внимания: геном комнатной мухи M. domestica, а также ее транскриптом, полностью секвенированы. Для комнатной мухи, относящейся к тому же отряду Diptera, что и D. melanogaster, процессы метилирования, возможно, могут иметь большее значение, чем для плодовой мушки, в связи с использованием в природе пищевых субстратов, обогащенных незаменимыми аминокислотами и витаминами. Наши эксперименты преследовали цель установить наличие 5-метилцитозина в ДНК комнатной мухи и возможную динамику его содержания в процессе онтогенеза. Материалы  и методы Ведение культуры насекомых. Имаго лабораторной исходной линии S (производной от линии Cooper, любезно переданной нам проф. С. А. Рославцевой, НИИ дезинфектологии, Москва) и линии Shgen с укороченной продолжительностью жизни, выведенной в лаборатории физиологической генетики Института биохимии и генетики УНЦ РАН, содержали в капроновых садках 30х30х30 см с металлическим каркасом, корм - сухое молоко. Личинки развивались в пластиковых контейнерах с увлажненными отрубями в стандартных условиях при комнатной температуре (+23…+26 °С), освещение с фотопериодом 12:12 [Беньковская, 2010]. Линия S была использована нами на этапе предварительных экспериментов, для подбора времени экспозиции при повышенной температуре и для проверки отсутствия прямой токсичности в экспериментах с дополнительными донорами метильных групп. В последующих сериях экспериментов мы использовали  большей частью линию Shgen, в силу постоянной селекции по признаку ранней репродукции отличающейся большей гомогенностью.  Тепловой стресс проводили на стадии личинки III возраста линии Shgen. Личинок в индивидуальных эппендорфах подвергали экспозиции при + 40°С на протяжении 10 мин (всего в серии экспериментов взято 60 особей), затем их переносили в чистый субстрат для развития.  В качестве дополнительных источников метильных групп в пище мы использовали метионин (М), S-аденозилметионин (SAM) в составе фармакологического препарата Гептрал©, и фолиевую кислоту (Ф) как кофактор трансформации метионина, в концентрациях, соответствующих физиологическим дозам для животных (12 мкг/мл молока для М и SAM, 1,2 мкг/мл для Ф) и, соответственно, в 10-кратных дозах (120 мкг/мл и 12 мкг/мл). Молочную смесь с добавками (1 мл) наносили на ватные диски диаметром  6 см в чашках Петри, затем рассаживали личинок комнатной мухи в 3х-кратной повторности по 15 особей в каждом варианте. Наблюдения проводились в течение всего онтогенеза и всего периода имагинальной жизни. В качестве объекта исследований использовались личинки в возрасте 7 суток (III возраст) из линии Shgen. Подготовка препаратов тканей. Мышечно-покровные ткани личинок III возраста получали, полностью удаляя внутренние органы и переднюю часть тела личинки. Для получения гомогената на стадии 1-суточного пупария удаляли верхнюю часть кокона. Прокалывали наконечником поверхность и отбирали содержимое пупария. Для выделения ДНК на стадии имаго брали освобожденные от покровов мышцы торакса.  Взятые ткани помещали в лизирующий буфер (50 мкл/особь), гомогенизировали стеклянным пестиком и после добавления протеиназы К оставляли на инкубацию при комнатной температуре на ночь.   Выделение ДНК. В экспериментах использовали индивидуально выделенную ДНК (36-40 особей из каждой линии). Экстракцию ДНК из предварительно гомогенизированных и инкубированных с протеиназой К в течение ночи тканей осуществляли фенол-хлороформной смесью (1:1). Депротеинизированную ДНК осаждали двумя объемами 96% этанола. Промытый 70% после центрифугирования осадок ДНК растворяли в бидистиллированой воде. Энзиматический гидролиз ДНК. Рестрикцию ДНК (20-30 нг) соответствующими ферментами, используя по 5-10 ед. EcoRI, MspI, HpaII, BisI (СибЭнзим, Россия) на образец, проводили в присутствии рекомендуемых фирмой-производителем буферов в течении 16 час. Расщепление ДНК рестриктазой Bsp1431 фирмы  Fermentas, Литва, проводили в аналогичных условиях.  Количественная полимеразная цепная реакция в режиме реального времени (qПЦР-РВ). Реакцию амплификации в режиме реального времени (ПЦР-РВ) проводили в 25 мкл реакционной смеси, содержащей 2-3 нг рестрицированной ДНК и интеркалирующий краситель SYBR Green I в составе ПЦР Микса (Синтол, Россия) в пробирках объемом 0,2 мл на термоциклере RotorGene 6000 фирмы Corbett Research (Австралия). Статистическую обработку результатов проводили с использованием пакета программ Excell 2003.  Результаты и обсуждение Геном комнатной мухи M. domestica размером в 691 м.п.о. содержит 15345 генов. В сравнении с D. melanogaster в нем выше содержание повторенных элементов, значительная часть генома представлена генами, имеющими отношение к  системам иммунитета, хеморецепции и детоксикации ксенобиотиков; в регуляции активности генов широко используется альтернативный сплайсинг и контроль посредством miRNA и других некодирующих белок РНК [Scott et al., 2014]. У комнатной мухи в геноме выше доля уникальных последовательностей, не передающихся с яйцеклеткой (т.е. по материнской линии), транскрибирующихся в мРНК, что, по всей видимости, осуществляется в процессе уже своего онтогенеза. У дрозофилы выше доля генов, транскрипты которых уже имеются в яйцеклетке и транскрипция которых не обязательна на ранних стадиях онтогенеза [Hough-Evans et al., 1980]. Таким образом, у комнатной мухи разнообразие способов онтогенетической регуляции активности генов может быть выше. чем у дрозофилы, а метилирование ДНК может быть более выраженным. К сожалению, полногеномное секвенирование с использованием бисульфитной конверсии ДНК на комнатной мухе пока не проведено, но по аналогии с D. melanogaster, можно было ожидать как сообщений о полном отсутствии метилирования ДНК [Zemach et al., 2010; Raddatz et al., 2013], так и о том, что метилирование ее ДНК динамически меняется в процессе онтогенеза, и de novo метил-трансферазная активность, не связанная с Dnmt2, должна присутствовать в оплодотворенной яйцеклетке [Takayama et al., 2014]. Связано это, прежде всего, с разрешающей силой метода - в связи с низким содержанием 5mC в ДНК D. melanogaster требуется большее число чтений при секвенировании или же предварительное обогащение ДНК иммунологическими методами. То что, ДНК M. domestica не содержит в заметном количестве 5mC, было установлено уже давно с использованием метил-чувствительных рестрикционных эндонуклеаз. Сам метод, в тогдашнем его исполнении, никак не мог считаться количественным и позволял только выявить сам факт наличия высокого уровня метилирования цитозина в CG-мотивах в геномах позвоночных животных и высших растений и отсутствие такового в ДНК беспозвоночных [Rae and Steele, 1979]. После его усовершенствования - перевода в количественную ПЦР в режиме реального времени с использованием метил-зависимых эндонуклеаз - метод может применяться даже для выявления избыточного метилирования регуляторных областей генов-онкосупрессоров и определения типа онкопатологии [Гончар, 2010].  Для большей части исследованных геномов насекомых характерным является наличие бимодальности в нормализованном содержании CG-динуклеотидов в ДНК кодирующих областей генов. Геном содержит два класса генов: 1) подвергающихся метилированию, с пониженным содержанием CG-динуклеотидов; 2) не подверженных метилированию и содержащих CG-динуклеотиды на уровне ожидаемого [Glastad et al., 2011]. Таким образом, нехватка CG-динуклеотидов в экзонах генов исследуемых видов организмов может косвенно свидетельствовать в пользу предположения, что ДНК в этих участках подвергается (или подвергалась в прошлом в процессе эволюции вида) метилированию. Замещение динуклеотидов CG на TG связано с повышенной мутабильностью 5mC по сравнению с обычным цитозином [Mazin, 2009].  Исходя из необходимости обоснования выбора конкретного объекта исследования, мы сравнили несколько последовательностей кодирующих областей генов у дрозофилы и комнатной мухи по содержанию динуклеотида CG (Табл. 1 и 2).  Таблица 1. Последовательности ДНК D. melanogaster и M. domestica, использованные для определения возможного дефицита динуклеотида CG в кодирующих областях генов. Символ Accession No Функции ODCDm, odc X66601 D. melanogaster ornithine decarboxylase; орнитин декарбоксилаза дрозофилы CYPDm, cyp NM_057810 D. melanogaster cytochrome P450 reductase; цитохром P450 редуктаза дрозофилы hobo X04705 D. melanogaster transposable element; ДНК-транспозон дрозофилы ODCMd, odc AF411043 M. domestica ornithine decarboxylase; орнитин декарбоксилаза комнатной мухи  CYPMd, cyp6d1 AF064794 M. domestica cytochrome P450 6D1 (CYP6D1); цитохром P450 6D1 комнатной мухи hermes L34807 M. domestica transposable element; ДНК транспозон комнатной мухи При проведении частотного анализа использовалась формула CpG O/E=CpG/C*G, где CpG - частота встречаемости динуклеотида CpG в ДНК, а C и G - частоты встречаемости соответствующих нуклеотидов [Elango et al., 2009].  Таблица 2. Нормализованная частота встречаемости динуклеотидов в кодирующих областях генов, Eest/Epredicted Динуклеотид  D. melanogaster M. domestica  ODCDm CYPDm hobo ODCMd CYPMd hermes CG  0.916 1.026 0.552 0.654 0.834 0.712 CA  1.188 1.189 1.002 0.885 1.066 0.984 TG  1.315 1.096 1.119 1.486 1.265 1.027 TA  0.461 0.556 0.712 0.751 0.686 0.869 Как видно из результатов расчетов (табл. 2), у дрозофилы в кодирующей области ДНК транспозона hobo отмечается нехватка CG-динуклеотидов. Вполне возможно, что активность этого транспозона могла подвергаться регулированию метилированием цитозина в процессе его «доместикации». В ДНК генов ферментов метаболизма дрозофилы, odc и cyp, нет явного дефицита динуклеотида CG. По всей видимости, в процессе эволюции дрозофилы как вида ДНК в кодирующих областях этих генов не метилировалась. У комнатной мухи, напротив, тенденция к замещению в кодирующей области CG- на TG-динуклеотиды в разной степени выражена для последовательностей всех рассматриваемых генов. Это позволило высказать предположение, что метилирование цитозина в CG положении могло иметь место ранее в процессе эволюции генома комнатной мухи, а в настоящее время может спорадически осуществляться в ограниченной части его локусов.  Для определения возможного присутствия 5mC в ДНК комнатной мухи мы использовали метод метилчувствительной ПЦР, наиболее известный вариант которой включал в себя гидролиз ДНК ферментом HpaII с последующей ПЦР с праймерами, лежащими справа и слева от сайта узнавания фермента 5’-CCGG-3’ в исследуемом районе ДНК [Singer-Sam et al., 1990].  Метод основывается на отсутствии способности эндонуклеазы HpaII расщеплять сайт 5’-C(5mC)GG-3’, что приводит к образованию соответствующего продукта ПЦР, тогда как неметилированный сайт узнавания полностью расщепляется ферментом и продукт в процессе ПЦР не образуется. В схему эксперимента мы добавили варианты с использованием рестриктаз MspI (изошизомер HpaII, нечувствительный к метилированию внутреннего цитозина), BisI (метилзависимая эндонуклеаза, узнает последовательность G(5mC)NGC, Bsp1431 (метилчувствительная, не гидролизует ДНК в последовательности GAT(5mC), EcoRI (чувствительна к метилированию в последовательности GAATT(5mC).  На рис 1. представлены схемы кодирующих областей генов odc, cyp6d1, 18s rRNA и 16s mtRNA комнатной мухи, амплифицируемых в процессе ПЦР с указанием сайтов выше перечисленных рестриктаз, а последовательности праймеров приведены в табл. 3. Рис. 1. Физическая карта последовательностей ампликонов, образующихся в процессе ПЦР с использованием праймеров: А- Odc1F и Odc2R, Б- Cyp1f и Cyp2r, В- 18s212F и 18s370R, Г- Mdmet1U и Mdmet2D.  Таблица 3. Последовательности праймеров, использованных для амплификации последовательностей отдельных генов M. domestica с помощью количественной ПЦР-РВ. Локус Функции  Название праймеров Последовательность праймера  Длина ампликона, п.о. AF411043 ornithine decarboxylase (ODC) gene Odc1F Odc2R caagttctggatttgggtgtc atgtttatgcagcttatggatttc 148 AF064794 cytochrome P450 6D1 (CYP6D1) Cyp1f Cyp2r gttgagtcgacggcggaaaat catagatggtaaatgatgttgtgg 121 EU154477 large subunit mitochondrial ribosomal (16S) RNA Mdmet1U Mdmet2D ttaaagatagaaaccaac tagggataacagcgtaat 179 DQ133074 18S ribosomal RNA gene 18s212F 18s370R taacttgcagatcgtatggtc gatgtggtagccgtttctca 159 Рис. 2. Количественная ПЦР с использованием праймеров Odc1F и Odc2R, специфичных к гену орнитин-декарбоксилазы odc Musca domestica. ДНК расщепляли рестриктазами: Bi - BisI, Bs - Bsp1431, E-EcoRI,  H-HpaII, M-MspII. K - контрольная ДНК, не расщепленная рестриктазами. Рис. 3. Количественная ПЦР с использованием праймеров Cyp1f и Cyp2r,  специфичных к гену цитохром P450 6D1 cyp6d1 Musca domestica. Рис. 4. Количественная ПЦР с использованием праймеров Mdmet1U и Mdmet2D, специфичных к гену рибосомной РНК большой субъединицы рибосомы 16s mtRNA Musca domestica На рис. 2-4 представлены результаты ПЦР-РВ с использованием праймеров, специфичных для генов odc, cyp6d1 и 16s mtRNA комнатной мухи. Результаты, сведенные в табл. 4, однозначно указывают на то, что эффективность ПЦР на матрице, представляющей собой нативную ДНК, значительно ниже, чем на предварительно гидролизованной ферментами на относительно короткие фрагменты. Это вполне согласуется с рекомендациями к включению процедуры предварительного гидролиза ДНК рестриктазой, не имеющей сайтов в пределах амплифицируемого участка (Fulnecek and Kovarik, 2014). Кольцевая форма митохондриальной ДНК представляет собой «трудную мишень» для амплификации и также требуется ее предварительное расщепление рестриктазой для линеаризации. В дальнейших экспериментах ДНК комнатной мухи мы предварительно расщепляли рестриктазой EcoRI, которую затем инактивировали нагреванием при 80°С в течении 10 мин.  Установлено, что профили метилирования в соматических тканях животных и растений  могут меняться при изменении диеты или стрессе, вызванном различными факторами [Lim et al., 2012; Solis et al., 2012]. Возможности организма на такую выраженную реакцию ограничиваются наличием в доступной форме пула доноров метильных групп и функционированием на данной стадии ДНК-метилтрансфераз. У комнатной мухи, как и дрозофилы, по всей видимости, отсутствуют гены Dnmt1 и Dnmt3, а продукт гена Dnmt2, субстратом которого является ДНК и тРНК, активен только на ранних стадиях эмбриогенеза [Law et al., 1976]. Данные таблицы 5 показывают хотя и невысокое, но воспроизводящееся увеличение устойчивости ДНК к расщеплению рестрикционными эндонуклеазами MspI и HpaII после теплового стресса для генов  ODC и CYP, особенно заметное на стадии пупария. По-видимому, это результат маскирующих метилирование микромутаций, индуцированных тепловым стрессом в соматических тканях. Значимого уровня метилирования, как и ожидалось, мы не наблюдали, поскольку метилтрансфераза Dnmt2 на стадии постэмбрионального развития уже не работает.  Таблица 4. Эффективность ПЦР на ДНК, предварительно расщепленной рестриктазами,  различающихся чувствительностью к метилированию цитозина.  ODC CYP mt16sRNA Контроль 100% 100% 100% + EcoRI 195% 191% 210% + BisI 167% 128% 226% + Bsp1431 nd 113% 0.002% + MspI nd nd 0.05% +HpaII 0.12% 1.18% 0.04% Примечание: nd - накопление продукта ПЦР не отмечено. Таблица 5. Устойчивость ДНК M. domestica линии Shgen к гидролизу рестрикционными эндонуклеазами MspI и HpaII на последующих после теплового стресса стадиях онтогенеза. (% ДНК, устойчивой к гидролизу).  ODC CYP mt16sRNA  MspI HpaII MspI HpaII MspI HpaII Пупарии, контроль nd 0.23 ±0.08 0.01 ±0.005 0.38 ±0.09 0.26 ±0.23 1.04 ±0.90 Пупарии,стресс 1.55 ±0.47 1.34 ±0.61 0.75 ±0.23 1.23 ±0.58 2.04 ±0.37 1.54 ±0.79 Имаго (самки), контроль nd 0.59 ±0.28 nd 3.37 ±1.19 0.61 ±0.22 0.41 ±0.31 Имаго (самки), стресс nd 1.35 ±0.43 0.08 ±0.06 4.39 ±1.98 0.47 ±0.15 0.69 ±0.33 С целью повышения разрешающей способности метода и вычленения влияния собственно метилирования на устойчивость ДНК к обработке рестрикционными эндонуклеазами мы выбрали в качестве мишени последовательность гена 18S рРНК, копийность которого составляет до 1000 копий на гаплоидный геном. У выживших после воздействия на стадии личинки избытка доноров метильных групп взрослых особей линии Shgen (табл. 6) мы наблюдали пониженный уровень устойчивости ДНК в области гена 18S рРНК к гидролизу рестрикционной эндонуклеазой HpaII. Это говорит о том, что метилирование, спровоцированное избытком доноров метильных групп, может снизить выживаемость потомства и сократить продолжительность жизни  имаго, особенно самок. Этот факт дает нам основание считать, что метилирование ДНК в CG-положении должно у комнатной мухи присутствовать, хотя и в меньших масштабах, чем у других видов насекомых.  Таблица 6. Устойчивость ДНК имаго M. domestica линии Shgen в области гена 18S рРНК к гидролизу рестрикционной эндонуклеазой HpaII в зависимости от содержания доноров метильных групп в пище, полученной ими на стадии личинки. Варианты Пол % рДНК, устойчивой к гидролизу HpaII Контроль самки 10.72±8.08  самцы 2.60±1.81 +Метионин самки 5.57±4.48  самцы 0.94±0.38 +Метионин+Фолиевая кислота самки 4.23±1.81  самцы 1.64±0.09 +Адеметеонин (SAM) самки 1.34±0.36  самцы 0.31±0.39 +10Х Адеметионин самки 0.65±0.59  самцы nd* Примечание: nd* - определение не производилось по причине отсутствия доживших до 3-ей недели самцов.  Если у представителей отрядов Coleoptera и Hymenoptera по аналогии с теплокровными животными наблюдается симметричное метилирование в кодирующих областях примерно для 25% всех генов, задействованных в процессах развития, то у дрозофилы основная часть этих генов не метилирована. Оказалось, что у нее метилируются не СG, а СА/СТ участки с малым количеством гуанина (G), причем в основном метилируются простые последовательности. В онтогенезе метилирование начинается на стадии 5 эмбриональной фазы, и далее уровень метилирования резко снижается. Метилирование осуществляется, вероятно, при участии еще не выявленной криптической метилтрансферазы [Takayama et al., 2014].  У комнатной мухи, в отличие от дрозофилы, практически утратившей СG-метилирование, этот тип метилирования, судя по нашим данным, должен присутствовать. Мы можем предположить, что обнаруженные нами свидетельства наличия метилирования в исследованных участках, правда, на невысоком или «фоновом» уровне, могут говорить о том, что эти участки находятся поблизости от мажорных сайтов метилирования. Опираясь на полученные данные, в дальнейшем можно сосредоточить усилия на исследовании тех генов, ДНК которых может быть метилирована с наибольшей вероятностью.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз