Оптимальные условия применения пробиотиков в качество адаптогенов на основе анализа имунного статуса медоносной пчелы

Авторы:
Гайфуллина Л.Р. , Салтыкова Е.С. , Матниязов Р.Т. , Николенко А.Г.
Название:
Оптимальные условия применения пробиотиков в качество адаптогенов на основе анализа имунного статуса медоносной пчелы
Страницы:
76-81
скачано
25 раз(а)


Исследовано влияние пробиотика Ветоспорина Ж на основе спорообразующих бактерий Bacillus subtilis на физиолого-биохимическое состояние медоносной пчелы в норме и при развитии патологических процессов в кишечнике, вызванных действием имидаклоприда. Показано, что в организме медоносной пчелы Ветоспорин Ж выступает в качестве иммуностимулятора, активируя фагоциты и ферменты фенолоксидазной и антиоксидантной систем, а также повышая уровень экспрессии генов вителлогенина и абецина. Ветоспорин Ж оказывает адаптогенное действие на рабочих пчел летней генерации при последующей интоксикации насекомых имидаклопридом.
ВВЕДЕНИЕ В настоящее время среди адаптогенов, применяемых для восстановления устойчивости медоносной пчелы, особый интерес вызывают пробиотики. В основном на российском рынке для пчеловодства рекомендованы пробиотики, разработанные для ветеринарии, на основе Bacillus subtilis и B. licheniformis (Ветом, Олин, Ветоспорин, Танг) и Lactobacillus, Bifidobacterium, Enterococcus (Эмпробио, Апиник). Показано, что стимулирующие подкормки, содержащие пробиотические препараты, улучшают микробиоценоз кишечника пчел, повышают силу, зимостойкость, продуктивность пчелиных семей, репродуктивные показатели маток [Бармина и др., 2011, Маннапов и Ларионова, 2011, Мишуковская, 2015], подавляют патогенные для пчел микрорганизмы [Forsgren et al., 2009, Arredondo et al., 2014, Janashia et al., 2014]. На практике же результаты применения данных препаратов не столь однозначны, что, по-видимому, связано с иммунным статусом, восприимчивостью к болезням, составом микрофлоры пищеварительного тракта и другими индивидуальными особенностями пчелиных семей. Механизм прямого действия пробиотических препаратов связывают с генерацией микроорганизмами антибактериальных соединений (органических кислот, перекиси водорода, диацетила, бензоата и бактериоцинов) [Moritz et al., 2010]. Опосредованное действие пробиотиков - путем активации иммунных систем организма - хорошо изучено у млекопитающих и человека [Калюжин, 2012] и крайне фрагментарно у насекомых. В данной работе исследовано влияние пробиотика Ветоспорина-Ж на иммунные факторы медоносной пчелы в норме и на фоне иммунодефицитного состояния, вызванного действием имидаклоприда. Ветоспорин-Ж - разработанный ООО ВНП «Башинком» живой микробиологический препарат, состоящий из двух штамов - B. subtilis 11B и 12 В, которые находятся в споровой форме. С кормом споры попадают в кишечник животного, где переходят в вегетативную форму, прорастают и продуцируют антибактериальные вещества, литические и пищеварительные ферменты, вступают в конкуренцию за питательные субстраты с патогенной микрофлорой и вытесняют ее из кишечника. Для медоносной пчелы рекомендован в качестве осенней и весенней подкормки для оздоровления кишечника, профилактики и лечения болезней, увеличения силы и продуктивности пчелиной семьи. Нами исследовалась возможность применения данного препарата в летний период и его иммунные мишени непосредственно у медоносной пчелы. МАТЕРИАЛЫ И МЕТОДЫ Объектом исследования служили фуражирующие рабочие особи Apis mellifera (в возрасте 2-3 недель), которых содержали в капроновых садках (30х30х30 см) на 60%-ном медовом сиропе. Обработку пчел пробиотиком производили путем разведения 0.1 мл Ветоспорина Ж в 100 мл медового сиропа. Состояние иммунодефицита индуцировали однократной обработкой пчел имидаклопридом СК20 с использованием готовой препаративной формы в виде препарата Танрек (200г/л), разведенной в медовом сиропе. Схема эксперимента включала следующие варианты: 1. Контроль - пчелы кормились медовым сиропом. 2. Пробиотик - пчелы кормились медовым сиропом, содержащим Ветоспорин Ж. спустя 3 суток взятие проб. 3. Пробиотик + имидаклоприд (предобработка) - пчелы кормились сиропом, содержащим Ветоспорин Ж, через 3 суток обрабатывались имидаклопридом, спустя 1 сутки взятие проб. 4. Имидаклоприд 1 - пчелы обрабатывались имидаклопридом, спустя 1 сутки взятие проб (контроль для 3-го варианта). 5. Имидаклоприд + пробиотик (постобработка) - пчелы обрабатывались имидаклопридом, через 1 сутки кормились сиропом, содержащим Ветоспорин Ж, спустя 3 суток - взятие проб. 6. Имидаклоприд 3 - пчелы обрабатывались имидаклопридом, спустя 3 суток взятие проб (контроль для 5-го варианта). Оценивали состояние кишечника и жирового тела, морфо-функциональную структуру гемоцитов и определяли активность ферментов фенолоксидазной и антиоксидантной систем в гемолимфе и кишечнике пчел, а также уровень экспрессии генов абецина и вителлогенина в жировом теле. Для гематологического анализа препараты гемолимфы фиксировали этиловым спиртом и окрашивали азур-эозином. Гематологический анализ проводили в 5 повторностях для каждого типа препаратов с использованием микроскопа AxioImager M1 (Carl Zeiss). Степень развития жирового тела оценивали по шкале Маурицио [Маурицио, 1958], состояние кишечника - по 4-бальной шкале [Сердюченко, 2009]. Выделение ферментативной субстанции проводили в трис-HCl экстрагирующем буфере (рН 7.5). Активность фенолоксидазы (о-дифенол: О2 оксидоредуктаза НФ 1.10.3.1) оценивали по скорости окисления L-ДОФА [Раушенбах, 1997]. Активность фермента выражали в ед.акт./мин/мг белка. Активность пероксидазы (донор: перекись водорода-оксидоредуктаза НФ 1.11.1.7) оценивали по скорости окисления бензидина [Бояркин,1957]. Удельную активность выражали в ед.акт./мин/мг белка. Активность супероксиддисмутазы (супероксид'супероксид-оксидоредуктаза, НФ 1.15.1.1) регистрировали по интенсивности ингибирования гомогенатом восстановления НСТ. Оптическую плотность измеряли на спектрофотометре Shimadzu. Активность ферментов оценивали в 3-х биологических и 3-х аналитических повторностях в пересчете на 1 мг белка, концентрацию которого определяли по Бредфорду, используя в качестве стандарта бычий сывороточный альбумин [Скоупс, 1985]. Выделение РНК из жирового тела пчел проводили с использованием “Trizol Reagent” в соответствии с протоколом фирмы-изготовителя (Invitrogen). кДНК получали из суммарной РНК с использованием набора реагентов для проведения обратной транскрипции (СИНТОЛ). ПЦР в режиме реального времени проводили с использованием набора реагентов для проведения ПЦР-РВ в присутствии SYBR Green I на приборе iCycler iQ™ Real-Time PCR Detection System (Bio-Rad, США). Реакционные смеси содержали геноспецифические праймеры: для гена абецина (прямой CAGCATTCGCATACGTACCA, обратный GACCAGGAAACGTTGGAAAC) [Evans et al., 2004], вителлогенина (прямой CCGACGAGGACCTGTTGATTA, обратный CTAGGATACGTGGTCATGACA) [Koywiwattrakul, 2005] и митохондриальной глутатион-S-трансферразы (mgst) (прямой TTGCTCTGTAAGGTTGTTTTGC, обратный TGTCTGGTTAACTACAAATCCTTCTG) [Gregory, 2005]. Уровень экспрессии генов абецина и вителлогенина выравнивали по «гену домашнего» хозяйства mgst. Статистический анализ полученных данных проводили с использованием среднеарифметического значения, стандартной ошибки, t критерия Стюдента с помощью программного обеспечения MS Excel 98 (Microsoft). Достоверными считали различия при p меньше 0.05. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ Физиолого-биохимическое состояние пчел при действии ветоспорина. Состояние кишечника и жирового тела зависят от экологических факторов и являются индикаторами физиологического состояния насекомого [Пашаян и др., 2008]. В ранее проведенных исследованиях было показано положительное влияние пробиотиков на микробиоценоз кишечника и развитие жирового тела [Маннапов и Ларионова, 2011, Мишуковская, 2015] В нашем эксперименте действие ветоспорина достоверно не изменило продолжительность жизни в сравнении с контролем и не сказалось на состоянии кишечника и уровне развития жирового тела (Таблица 1). Таблица 1. Жизненные показатели рабочих пчел при действии пробиотика и имидаклоприда Вариант Средняя продолжительность жизни, сут. Степень развития жирового тела, балл Состояние кишечника, балл контроль 11.8±1.2 2.8±0.3 3.8±0.4 пробиотик 11.0±1.0 2.7±0.4 3.8±0.6 имидаклоприд 9.0±1.4 1.4±0.4 2.2±1.2 пробиотик+имидаклоприд 12.2±1.4 1.8±0.2 3.6±0.8 имидаклоприд+пробиотик 8.0±0.9 1.6±0.3 1.8±0.4 В ходе гематологического анализа были идентифицированы родоначальные клетки прогемоциты, фагоциты: гранулоциты и плазматоциты амебоидной и веретеновидной формы, метаболические клетки сферулоциты и эноцитоиды (Рисунок 1). 0 5 10 15 20 25 30 35 40 45 К П И1 П+И И3 И+П % а ГЦ вГЦ аПЦ вПЦ СЦ ЭЦ Рисунок 1. Изменение процентного соотношения иммунных клеток гемолимфы рабочих пчел при действии ветоспорина и имидаклоприда СК20. П - пробиотик, И - имидаклоприд, 1 и 3 - 1 и 3 сутки, П+И - пробиотик с последующей обработкой имидаклопридом, И+П - имдаклоприд с последующей обработкой пробиотиком. Действие ветоспорина вызвало увеличение доли веретеновидных гранулоцитов и плазматоцитов за счет сокращения их амебоидных форм, иными словами, характерную для противоинфекционого ответа активацию фагоцитов без качественных патологческих изменений гемолимфы, таких как вакуолизация, фрагментация и лизис цитоплазмы гемоцитов, децентрализация и пикноз ядер, увеличение количества мертвых клеток. При действии ветоспорина также регистрировалось значительное повышение уровня экспресси гена вителлогенина и абецина в жировом теле (Рисунок 2). Ветоспорин также индуцировал значительное повышение уровня активности ферментов фенолоксидазной и антиоксидантной систем в гемолимфе и кишечнике рабочих пчел (Рисунок 3). Рисунок 2. Уровень экспрессии генов вителлогенина и абецина в жировом теле рабочих пчел при действии Ветоспорина. К - контроль, П - пробиотик. Рисунок 3. Активность ферментов АО и ФО систем при действии Ветоспорина и имидаклоприда СК20. П - пробиотик, И - имидаклоприд, 1 и 3 - 1 и 3 сутки, П+И - пробиотик с последующей обработкой имидаклопридом, И+П - имдаклоприд с последующей обработкой пробиотиком. Изменения в уровне экспрессии генов вителлогенина и абецина, а также активности ферментов фенолоксидазной и антиоксидантной систем демонстрируют усиление гуморальной защиты пчел в результате действия проботика. Фенолоксидазная система выступает в качестве интегрального звена иммунных реакций насекомых, участвуя практически во всех клеточных и гуморальных иммунных реакциях [Theopold et al., 2004], и функционально связана с антиоксидантной системой, снижающей окислительное повреждение собственных клеток и тканей [Глупов и др., 2009]. Абецин - пролинбогатый длинноцепочечный незамещенный пептид, специфичный для Hymenoptera и обладающий бактерицидной активностью по отношению к грам-положительным и грам-отрицательным бактериям [Garrido et al., 2013]. Уровни данного пептида возрастают, как при проникновении в организм пчел различных патогенов, так и при действии естественных пробиотиков, что может служить критерием иммунокомпетентности отдельных пчелиных семей [Evans and Lopes, 2004]. Вителлогенин - белок, выполняющий в организме медоносной пчелы множество функций, в том числе антиоксидантные и иммунные. Непосредственные антиоксидантные функции вителлогенина в организме медоносной пчелы обусловлены его Zn-связывающей способностью [Amdam et al., 2004] и преимущественным окислительным карбонилированием при оксидативном стрессе пчел [Seehuus et al., 2006]. Иммуногистохимия пчелиных тканей и Вестерн-блоттинг показывают, что Vg связывается с клетками и мембранными структурами здоровых тканей и обеспечивает непосредственную защиту клеток от атаки реактивных форм киcлорода [Havukainen et al., 2013]. Вместе с тем, вителлогенин обладает гораздо большей аффинностью к мембранам мертвых и поврежденных клеток, а также липосом, содержащих отрицательно зараяженный фосфатидилсерин, в сравнении с мембранами здоровых клеток и липосомами с нейтральным фосфатидилхолином. Предполагается, что распознавание клеточных повреждений и защитное окисление - два механизма, которые позволяют вителлогенину продлить срок жизни медоносной пчелы. Помимо антиоксидантной защиты показано участие вителлогенина в иммунологическом распознавании [Zhang et al., 2011]. Так, вителлогенин связывается с различными видами бактерий: грамм-положительной бактерией Paenibacillus larvae, и грам-отрицательной бактерией Escherichia coli, а также с патоген-ассоциированными молекулярными паттернами [Salmela et al., 2015]. Более того, в данных исследованиях выявлена роль вителлогенина в трансгенерационном иммунном примировании качестве переносчика иммунных элиситоров [Salmela et al., 2015]. Физиолого-биохимическое состояние пчел при действии ветоспорина на фоне нейроинтоксикации. Ранее нами было показано, что блокирование имидоклопридом ацетилхолиновых рецепторов и передачи нервного импульса оказывает негативное влияние на функционирование клеточных и гуморальных систем иммунитета насекомых, вызывая в них деструктивные процессы [Гайфуллина, 2013]. Иммуносупрессивное действие имидаклоприда на медоносную пчелу позволило нам применить данный инсектицид для моделирования состояния иммунодефицита пчел. Предобработка пчел пробиотиком за 3 суток до нейроинтоксикации имидаклопридом СК20 увеличила продолжительность жизни насекомых до контрольного уровня. Действие ветоспорина после суточного действия неоникотиноида не сказалось положительно на выживаемости пчел. Предобработка ветоспорином также компенсировала негативное влияние имидаклоприда на состояние кишечника пчел, чего не наблюдалось при применении пробиотика после нейроинтоксикации. Степень деструктивных процессов в жировом теле не снижалась ни пред-, ни постобработкой пробиотиком. Нейроинтоксикация пчел сопровождалась уменьшением доли активных (веретеновидных) гранулоцтов. Следствием предобработки пчел ветоспорином явилась активация гранулоцитов и плазматоцитов, а также увеличение доли сферулоцитов и эноцитоидов. Обработка пчел ветоспорином после интоксикации имидаклопридом не сказалась положительно на качественных и количественных изменениях в популяции гемоцитов. Имидаклоприд СК20 вызвал наблюдавшуюся ранее реакцию: угнетение фенолоксидазной активности и активацию ферментов антиоксидантной защиты. Предварительная обработка пчел ветоспорином способствовала сохранению высоких уровней активности фенолоксидазы в гемолимфе и кишечнике на фоне повышенной антиоксидантной защиты при последующей нейроинтоксикации имидаклопридом. Постобработка пчел данным пробиотиком вызывала менее выраженную активацию данных ферментов. Микробиоценоз организма медоносной пчелы состоит из разнообразных сапрофитных, условно-патогенных и патогенных микроорганизмов и во многом определяется средой обитания насекомых (Чечеткина и др., 2011). Показано, что на состоянии кишечника пчел позитивно сказывается преобладание кислотопродуцирующих бактерий - лактобактерий и энтерококков, тогда как к развитию дисфункции пищеварительного тракта насекомых, вплоть до выраженных анатомических дефектов приводит повышенное содержание энтеробактерий, стафилококков, псевдомонад и плесневых грибов (Сердюченко, 2009). Последние, по всей видимости, подвергаются антагонистическому действию штаммов B. subtilis, улучшающему микробиоценоз кишечника пчел перед имидаклопридной интоксикацией и во время нее. Cостояние иммунодефицита у пчел, вызванное нейроинтоксикацией имидаклопридом, очевидно, сопровождается смещением микробного баланса в кишечнике в сторону патогенной флоры, достигающей уровня, который не нейтрализуется последующей обработкой Ветоспорином. ЗАКЛЮЧЕНИЕ Таким образом, Ветоспорин Ж оказывает на организм медоносной пчелы иммуномодулирующее действие, смягчая негативный эффект при последующей интоксикации неоникотиноидами, одного из ключевых современных факторов роста смертности пчелиных семей. Применение пробиотика на фоне уже состоявшейся интоксикации и сниженного иммунитета только ухудшает физиологическое состояние пчел. Последнее, очевидно, сопровождается смещением микробного баланса в кишечнике в сторону патогенной флоры, достигающей уровня, который не нейтрализуется Ветоспорином. Кроме того, здесь мы подтверждаем предположение Эванса, о реализации адаптивных свойств пробиотических микроорганизмов именно у пчелиных семей с достаточно высоким уровнем иммунореактивности. Уровень иммунореактивности, при введении пробиотиков в кишечник пчелы может служить новым высокоинформативным селекционным критерием для искусственного отбора пчелиных семей, устойчивых к инфекционным заболеваниям, что крайне актуально в свете современных проблем, связанных с применением антибиотиков и снижением общей устойчивости медоносной пчелы.
Заказ
Оформите заказ, наш сотрудник свяжется с вами для уточнения деталей.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз

Обратный звонок
Представьтесь, мы вам перезвоним.
Ваша заявка успешно отправлена!
Необходимо принять условия соглашения
Вы заполнили не все обязательные поля
Произошла ошибка, попробуйте ещё раз